Abstract: [Problem] To provide a composition and a cell sheet which are highly effective for inhibiting fibrosis, or cells having fibrosis-inhibiting activity, which are useful in regenerative medicine. [Solution] A medium containing IC-2 or a related compound is inoculated with mesenchymal stem cells or bone marrow mononuclear cells, and the cells are cultured for a prescribed period of time while the IC-2 or related compound is maintained at a constant concentration, thereby allowing a composition and a cell sheet which are highly effective for inhibiting fibrosis, or cultured cells having fibrosis-inhibiting activity, to be obtained.

Abstract: [Problem to be solved by the invention] To provide a cell sheet for increasing fibrosis inhibitory action, said cell sheet comprising bone marrow mononuclear cells, and a production method thereof. [Solution] A cell sheet comprising bone marrow mononuclear cells, said cell sheet being obtained by forming bone marrow mononuclear cells from a bone marrow mononuclear cell suspension into a sheet, and then shrinking and suspension culturing the result.

Abstract: A novel therapeutic drug for malignant tumors, cancer stem cells, or fibrosis is obtained. A therapeutic drug for malignant tumors or cancer stem cells is used that includes at least one compound selected from the group consisting of compounds represented by formulas (1), (2), and (5), a salt thereof, or a solvate thereof. Alternatively, a therapeutic drug for fibrosis can be used that includes at least one compound selected from the group consisting of compounds represented by formulas (1), (2), and (5), a salt thereof, or a solvate thereof.

Abstract: A novel therapeutic drug for malignant tumors, cancer stem cells, or fibrosis is obtained. A therapeutic drug for malignant tumors or cancer stem cells is used that includes at least one compound selected from the group consisting of compounds represented by formulas (1), (2), and (5), a salt thereof, or a solvate thereof. Alternatively, a therapeutic drug for fibrosis can be used that includes at least one compound selected from the group consisting of compounds represented by formulas (1), (2), and (5), a salt thereof, or a solvate thereof.

Abstract: [Problem] To provide a composition and a cell sheet which are highly effective for inhibiting fibrosis, or cells having fibrosis-inhibiting activity, which are useful in regenerative medicine. [Solution] A medium containing IC-2 or a related compound is inoculated with mesenchymal stem cells or bone marrow mononuclear cells, and the cells are cultured for a prescribed period of time while the IC-2 or related compound is maintained at a constant concentration, thereby allowing a composition and a cell sheet which are highly effective for inhibiting fibrosis, or cultured cells having fibrosis-inhibiting activity, to be obtained.

Abstract: [Problem to be solved by the invention] To provide a cell sheet for increasing fibrosis inhibitory action, said cell sheet comprising bone marrow mononuclear cells, and a production method thereof. [Solution] A cell sheet comprising bone marrow mononuclear cells, said cell sheet being obtained by forming bone marrow mononuclear cells from a bone marrow mononuclear cell suspension into a sheet, and then shrinking and suspension culturing the result.

Abstract: To obtain a novel therapeutic drug for a malignant tumor or fibrosis. Used is a compound represented by formula (1), a salt thereof, or a solvate thereof. Also used is a therapeutic drug for a malignant tumor or a therapeutic drug for fibrosis, comprising a compound represented by formula (1), a salt thereof, or a solvate thereof.

Abstract: To obtain a novel therapeutic drug for a malignant tumor or fibrosis. Used is a compound represented by formula (1), a salt thereof, or a solvate thereof. Also used is a therapeutic drug for a malignant tumor or a therapeutic drug for fibrosis, comprising a compound represented by formula (1), a salt thereof, or a solvate thereof.

Abstract: A novel therapeutic drug for malignant tumors, cancer stem cells, or fibrosis is obtained. A therapeutic drug for malignant tumors or cancer stem cells is used that includes at least one compound selected from the group consisting of compounds represented by formulas (1), (2), and (5), a salt thereof, or a solvate thereof. Alternatively, a therapeutic drug for fibrosis can be used that includes at least one compound selected from the group consisting of compounds represented by formulas (1), (2), and (5), a salt thereof, or a solvate thereof.

Abstract: The invention relates to low-molecular-weight compounds which are capable of inducing differentiation of mesenchymal stem cell into hepatocytes.

Abstract: The purpose is to select low-molecular-weight compounds which are effective in inducing differentiation of mesenchymal stem cell into hepatocyte and to develop a safe differentiation-inducing method having excellent efficiency of differentiating mesenchymal stem cell into hepatocyte. Provided are at least one compound selected from the group consisting of compounds represented by formulae (1) and (2), a salt thereof, or a solvate of them; a differentiation inducer comprising at least one compound selected from the group consisting of compounds represented by formulae (1) and (2), a salt thereof, or a solvate of them; and a differentiation inducer comprising a compound represented by formula (8), a salt thereof, or a solvate of them.

Abstract: To provide a cancer diagnostic method capable of detecting evidence presenting the presence of cancer cells in early stage cancer. Cancer diagnostic method comprised of; a process to obtain the sample containing RNA only as a somatic cell and cancer cell fraction from body fluid and a process having a reverse transcription reaction step to generate cDNA using reverse transcriptase from the sample containing said RNA only and a PCR reaction step utilizing fluorescent dye using the following primers for hTERT, CGGAAGAGTGTCTGGAGCAA and GGATGAAGCGGAGTCTGGA to quantify the PCR product amplified by the PCR reaction using the fluorescent dye binding to the PCR product.