Abstract: The present invention relates to a double pair of oligonucleotides for amplifying two target sequences located, respectively, in the H5 and N1 genes of the genome of the Influenza A virus, said oligonucleotides being of a length ranging between 10 and 50 nucleotides and comprising at least one fragment of 10 consecutive nucleotides derived from the following sequences: SEQ ID No. 1: TGTATGTTGTGGAATGGCA, SEQ ID No. 2: GCCGAATGATGCCATCAA, SEQ ID No. 3: CGTGGATTGTCTCCGAAA, and SEQ ID No. 4: GGAATGCTCCTGTTATCCTGA or the sequence complementary thereto. The invention also relates to oligonucleotides for detecting amplicons, to the use of all these sequences, and to a method for detecting and a kit for diagnosing the presence of the H5 and N1 genes of the Influenza A virus. The invention is particularly applicable in the field of diagnosis.

Abstract: Sequences of nucleic acid oligonucleotides for amplifying different portions of gag and pol genes of HIV-1 and for detecting such amplified nucleic acid sequences are disclosed. Methods of amplifying and detecting HIV-1 nucleic acid in a biological sample using the amplification oligonucleotides specific for gag and pol target sequences are disclosed.

Abstract: The present invention relates to a double pair of oligonucleotides for amplifying two target sequences located, respectively, in the H5 and N1 genes of the genome of the Influenza A virus, said oligonucleotides being of a length ranging between 10 and 50 nucleotides and comprising at least one fragment of 10 consecutive nucleotides derived from the following sequences: SEQ ID No. 1: TGTATGTTGTGGAATGGCA, SEQ ID No. 2: GCCGAATGATGCCATCAA, SEQ ID No. 3: CGTGGATTGTCTCCGAAA, and SEQ ID No. 4: GGAATGCTCCTGTTATCCTGA or the sequence complementary thereto. The invention also relates to oligonucleotides for detecting amplicons, to the use of all these sequences, and to a method for detecting and a kit for diagnosing the presence of the H5 and N1 genes of the Influenza A virus. The invention is particularly applicable in the field of diagnosis.

Abstract: Sequences of nucleic acid oligonucleotides for amplifying different portions of gag and pol genes of HIV-1 and for detecting such amplified nucleic acid sequences are disclosed. Methods of amplifying and detecting HIV-1 nucleic acid in a biological sample using the amplification oligonucleotides specific for gag and pol target sequences are disclosed.

Abstract: Disclosed is a method for controlling the microbiological quality of an environmental aqueous medium, suspected of containing various micro-organisms, having the following steps: selecting a reference set, having at least three micro-organisms, representing jointly or separately a microbiological quality level; providing a microbiological detection kit, having at least three probes specifically and respectively identifying said three micro-organisms; after treating the medium to be analyzed, contacting said micro-organisms, or any fraction thereof derived from the medium to be analyzed therefrom, with said detection kit, whereby a multiple determination of the micro-organisms is carried out, the determination representing the microbiological quality level of the medium.

Abstract: Sequences of nucleic acid oligonucleotides for amplifying different portions of gag and pol genes of HIV-1 and for detecting such amplified nucleic acid sequences are disclosed. Methods of amplifying and detecting HIV-1 nucleic acid in a biological sample using the amplification oligonucleotides specific for gag and pol target sequences are disclosed.

Abstract: The present invention is directed to novel nucleotide sequences to be used for diagnosis, identification of the strain, typing of the strain and giving orientation to its potential degree of virulence, infectivity and/or latency for all infectious diseases more particularly tuberculosis. The present invention also includes method for the identification and selection of polymorphisms associated with the virulence' and/or infectivity in infectious diseases more particularly in tuberculosis by a comparative genomic analysis of the sequences of different clinical isolates/strains of infectious organisms. The regions of polymorphisms, can also act as potential drug targets and vaccine targets. More particularly, the invention also relates to identifying virulence factors of M. tuberculosis strains and other infectious organisms to be included in a diagnostic DNA chip allowing identification of the strain, typing of the strain and finally giving orientation to its potential degree of virulence.

Abstract: Sequences of nucleic acid oligonucleotides for amplifying different portions of gag and pol genes of HIV-1 and for detecting such amplified nucleic acid sequences are disclosed. Methods of amplifying and detecting HIV-1 nucleic acid in a biological sample using the amplification oligonucleotides specific for gag and pol target sequences are disclosed.

Abstract: Sequences of nucleic acid oligonucleotides for amplifying different portions of gag and pol genes of HIV-1 and for detecting such amplified nucleic acid sequences are disclosed. Methods of amplifying and detecting HIV-1 nucleic acid in a biological sample using the amplification oligonucleotides specific for gag and pol target sequences are disclosed.

Abstract: The invention concerns a method for controlling the microbiological quality of an environmental aqueous medium, suspected of containing various micro-organisms, comprising the following steps: selecting a reference set, consisting of at least three micro-organisms, representing jointly or separately, a microbiological quality level; providing a microbiological detection kit, consisting of at least three probes specifically and respectively identifying said three micro-organisms; after treating the medium to be analysed, contacting said micro-organisms, or any fraction thereof derived from the medium to be analysed therefrom, with said detection kit, whereby a multiple determination of said micro-organisms is carried out, said determination representing the microbiological quality level of the medium. The invention also concerns an appropriate microbiological detection kit for implementing said method.

Abstract: Sequences of nucleic acid oligonucleotides for amplifying different portions of gag and pol genes of HIV-1 and for detecting such amplified nucleic acid sequences are disclosed. Methods of amplifying and detecting HIV-1 nucleic acid in a biological sample using the amplification oligonucleotides specific for gag and pol target sequences are disclosed.

Abstract: Sequences of nucleic acid oligonucleotides for amplifying different portions of gag and pol genes of HIV-1 and for detecting such amplified nucleic acid sequences are disclosed. Methods of amplifying and detecting HIV-1 nucleic acid in a biological sample using the amplification oligonucleotides specific for gag and pol target sequences are disclosed.

Abstract: Sequences of nucleic acid oligonucleotides for amplifying different portions of gag and pol genes of HIV-1 and for detecting such amplified nucleic acid sequences are disclosed. Methods of amplifying and detecting HIV-1 nucleic acid in a biological sample using the amplification oligonucleotides specific for gag and pol target sequences are disclosed.