Abstract: A reducing agent tank includes a tank body storing reducing agent and a cylindrical gauge member visually indicating a storage amount of the reducing agent inside the tank body. The gauge member is in communication with an inside of the tank body. The tank body has a replenishment port to replenish the reducing agent. The gauge member is provided on a first wall surface of a plurality of wall surfaces defining the tank body. The gauge member is provided in a slanted manner relative to a bottom plate of the tank body. The replenishing port and the gauge member are disposed in a row along a direction that extends along the first wall surface as seen in a plan view.

Abstract: A reducing agent tank includes a tank body storing reducing agent and a cylindrical gauge member visually indicating a storage amount of the reducing agent inside the tank body. The gauge member is in communication with an inside of the tank body. The tank body has a replenishment port to replenish the reducing agent. The gauge member is provided on a first wall surface of a plurality of wall surfaces defining the tank body. The gauge member is provided in a slanted manner relative to a bottom plate of the tank body. The replenishing port and the gauge member are disposed in a row along a direction that extends along the first wall surface as seen in a plan view.

Abstract: A protein participating in the addition of mannose phosphate to a sugar chain of a glycoprotein originating in a yeast belonging to the genus Pichia; a gene coding this protein; a mutant of this gene; a vector carrying the mutant gene; a yeast strain belonging to the genus Pichia having been transformed by this vector; a process for producing a protein with reduction of an acidic sugar chain by using the transformed yeast strain; and a glycoprotein thus produced, are described.

Abstract: A gene participating in addition of mannose phosphate to a sugar chain of a glycoprotein originating in a yeast belonging to the genus Pichia is described. Also described is a means of suppressing a functional product encoded by the gene.

Abstract: The present invention intends to find out a gene participating in addition of mannose phosphate to a sugar chain of a glycoprotein originating in a yeast belonging to the genus Pichia and provide a means of controlling the same. The present invention also intends to provide a process for producing a protein with reduction of an acidic sugar chain by using the thus controlled yeast strain belonging to the genus Pichia. Namely, the present invention includes a protein participating in the addition of mannose phosphate to a sugar chain of a glycoprotein; a gene coding this protein; a mutant of this gene; a vector carrying the mutant gene; a yeast strain belonging to the genus Pichia having been transformed by this vector; a process for producing a protein with reduction of an acidic sugar chain by using the transformed yeast strain; and a glycoprotein thus produced.

Abstract: The present invention intends to find out a gene participating in addition of mannose phosphate to a sugar chain of a glycoprotein originating in a yeast belonging to the genus Pichia and provide a means of controlling the same. The present invention also intends to provide a process for producing a protein with reduction of an acidic sugar chain by using the thus controlled yeast strain belonging to the genus Pichia. Namely, the present invention includes a protein participating in the addition of mannose phosphate to a sugar chain of a glycoprotein; a gene coding this protein; a mutant of this gene; a vector carrying the mutant gene; a yeast strain belonging to the genus Pichia having been transformed by this vector; a process for producing a protein with reduction of an acidic sugar chain by using the transformed yeast strain; and a glycoprotein thus produced.

Abstract: The present invention intends to find out a gene participating in addition of mannose phosphate to a sugar chain of a glycoprotein originating in a yeast belonging to the genus Pichia and provide a means of controlling the same. The present invention also intends to provide a process for producing a protein with reduction of an acidic sugar chain by using the thus controlled yeast strain belonging to the genus Pichia. Namely, the present invention includes a protein participating in the addition of mannose phosphate to a sugar chain of a glycoprotein; a gene encoding this protein; a mutant of this gene; a vector carrying the mutant gene; a yeast strain belonging to the genus Pichia having been transformed by this vector; a process for producing a protein with reduction of an acidic sugar chain by using the transformed yeast strain; and a glycoprotein thus produced.

Abstract: The present invention intends to find out a gene participating in addition of mannose phosphate to a sugar chain of a glycoprotein originating in a yeast belonging to the genus Pichia and provide a means of controlling the same. The present invention also intends to provide a process for producing a protein with reduction of an acidic sugar chain by using the thus controlled yeast strain belonging to the genus Pichia.

Abstract: A mutant AOX2 promoter wherein 1 to 3 oligonucleotide(s) GATAGGCTATTTTTGTCGCATAAAT (SEQUENCE ID NO: 2) is (are) added in the normal direction, the reverse direction or in both the normal and reverse directions at the 5' end side of a partial DNA fragment of a wild-type AOX2 promoter, a vector carrying the promoter, a transformant into which the vector has been introduced and a method for producing a heterologous protein, comprising culture of the transformant. The mutant AOX2 promoter of the present invention has a markedly enforced promoter activity as compared with wild-type AOX2 promoters. Accordingly, the promoter of the present invention is highly utilizable as a promoter to be carried by a vector capable of expressing a heterologous protein. The vector of the present invention can efficiently express and produce various useful heterologous proteins in hosts.

Abstract: A mutant AOX2 promoter obtained by mutating a sequence of natural AOX2 promoter in a manner comprising at least one of the three mutation modes of (1) a region extending upstream from nucleotide 1187 inclusive and comprising at least nucleotides 845-960 is deleted, (2) nucleotide(s) is(are) replaced in region(s) in nucleotides 1274-1314, and (3) new oligonucleotide(s) is (are) inserted in region(s) in nucleotides 1274-1314, a vector carrying said mutant AOX2 promoter, a transformant into which said vector has been introduced, and a method for producing a heterologous protein, which comprises cultivating said transformant. The promoter of the present invention has remarkably enhanced activity as compared with natural AOX2 promoter, and is highly useful as a promoter to be carried in an expression vector allowing heterologous protein expression. In addition, the vector and the transformant of the invention can efficiently express and produce various useful heterologous proteins.

Abstract: A rock specimen is step scanned in an electron probe x-ray microanalyzer. A plurality of x-ray spectrometers (for example three) forming a part of said electron probe x-ray microanalyzer simultaneously detect characteristic x-rays corresponding to three elements at each scanning point on the rock specimen. The concentration of each element is calculated from the output signals of said plurality of x-ray spectrometers and the calculated elemental concentrations are then converted into atomic ratios accordingly. From this information, the type of mineral at each scanning point is designated by a character which is recorded on a display means in synchronism with the step scanning so as to display a mineral map of the specimen being examined.