Abstract: A method and a kit for detecting methicillin-resistant Staphylococcus aureus which use, as primers in a gene amplification reaction, the four oligonucleotides represented by the following nucleotide sequences (1) through (4):5'AGAAATGACTGAACGTCCG3' (SEQ ID NO:1) (1)5'GCGATCAATGTTACCGTAG3' (SEQ ID NO:2) (2)5'TACATGTCGTTAAACCTGGTG3' (SEQ ID NO:3) (3)5'TACAGTTGTACCGATGAATGG3' (SEQ ID NO:4) (4)wherein A, G, C, and T denote adenine, guanine, cytosine, and thymine, respectively, and any T may be substituted by uracil (U). According to the method and kit of the present invention, it is possible to detect MRSA accurately and rapidly while distinguishing it from MR-CNS. Thus, proper treatment and prevention can be achieved against MRSA infections.

Abstract: A nucleic acid differentiating method is provided which involves using a primer having a detectable label introduced therein and a primer having a solid matrix-binding site introduced therein, amplifying a particular region of a target nucleic acid in a sample to thereby produce a labeled sample DNA, adding to this labeled sample DNA at least an equimolar amount of an unlabeled standard DNA to be evaluated for its sequence matching with the sample DNA, effecting competitive hybridization, and at the end of reaction, determining the label intensity of the hybridization product, for thereby determining the presence/absence of a mutant gene in the nucleic acid, the ratio of normal to mutant genes, or the sequence matching of a particular gene among a plurality of samples.