Abstract: A nozzle auto-cleaning device and a nozzle auto-cleaning method are disclosed. The nozzle auto-cleaning device includes a base and a cleaning piece feeding unit disposed on the base, the base has a bearing surface on which the cleaning piece feeding unit is disposed, the cleaning piece feeding unit is configured to transport a cleaning piece installed inside the nozzle auto-cleaning device along a first direction intersected with the bearing surface so that a first portion of the cleaning piece is protruded in a direction away from the bearing surface and inserted into a nozzle, and the base is configured to move along at least one direction of the first direction, as well as a second direction and a third direction intersected in a plane of the bearing surface, so as to drive the first portion of the cleaning piece to move inside the nozzle.

Abstract: A reusable casting head device comprises a casting head control mechanism, a casting head mechanism and a temperature control mechanism. A gate of the casting head is sealed by the gate holder to allow that initially heated molten aluminum is rapidly heated in the casting head, thus improving efficiency; the casting head made of beryllium copper is heated and maintained by the high-frequency heating ring, thus providing a high accuracy of temperature measurement and control; and the rotating cylinder, the positioning cylinder and the reverse rotating cylinder are employed for procedure operation to intelligentize the casting operation, thus providing low production cost.

Abstract: A nozzle auto-cleaning device and a nozzle auto-cleaning method are disclosed. The nozzle auto-cleaning device includes a base and a cleaning piece feeding unit disposed on the base, the base has a bearing surface on which the cleaning piece feeding unit is disposed, the cleaning piece feeding unit is configured to transport a cleaning piece installed inside the nozzle auto-cleaning device along a first direction intersected with the bearing surface so that a first portion of the cleaning piece is protruded in a direction away from the bearing surface and inserted into a nozzle, and the base is configured to move along at least one direction of the first direction, as well as a second direction and a third direction intersected in a plane of the bearing surface, so as to drive the first portion of the cleaning piece to move inside the nozzle.

Abstract: A reusable casting head device comprises a casting head control mechanism, a casting head mechanism and a temperature control mechanism. A gate of the casting head is sealed by the gate holder to allow that initially heated molten aluminum is rapidly heated in the casting head, thus improving efficiency; the casting head made of beryllium copper is heated and maintained by the high-frequency heating ring, thus providing a high accuracy of temperature measurement and control; and the rotating cylinder, the positioning cylinder and the reverse rotating cylinder are employed for procedure operation to intelligentize the casting operation, thus providing low production cost.

Abstract: The present invention relates to a rs6311 test kit, which includes a probe, a primer, and a polymerase chain reaction solution, wherein said probe sequence is as follows: rs6311T-fam: CTGTGAGTGTCTGGC (SEQ. ID. NO. 1) and rs6311C-vic: CTGTGAGTGTCCGGC (SEQ. ID. NO. 2); and said primer sequence is as follows: rs6311-F: AGAGAGAACATAAATAAGGCTAGAAAACAGTA (SEQ. ID. NO. 3) and rs6311-R: CACTGTTGGCTTTGGATGGA (SEQ. ID. NO. 4). The test kit is used to determine genotype of a depression patient, in order to treat the depression patient with a combination of serotonin reuptake inhibitors (SSRI) and low dose risperidone. The actual dose of risperidone and the ratio between SSRIs and risperidone is determined by the genotype of the depression patient. The present invention determines human drug metabolism rate through a single nucleotide polymorphism and provides a platform to adjust the patient's treatment.

Abstract: The present invention relates to a rs6311 test kit, which includes a probe, a primer, and a polymerase chain reaction solution, wherein said probe sequence is as follows: rs6311T-fam: CTGTGAGTGTCTGGC (SEQ. ID. NO. 1) and rs6311C-vic: CTGTGAGTGTCCGGC (SEQ. ID. NO. 2); and said primer sequence is as follows: rs6311-F: AGAGAGAACATAAATAAGGCTAGAAAACAGTA (SEQ. ID. NO. 3) and rs6311-R: CACTGTTGGCTTTGGATGGA (SEQ. ID. NO. 4). The test kit is used to determine genotype of a depression patient, in order to treat the depression patient with a combination of serotonin reuptake inhibitors (SSRI) and low dose risperidone. The actual dose of risperidone and the ratio between SSRIs and risperidone is determined by the genotype of the depression patient. The present invention determines human drug metabolism rate through a single nucleotide polymorphism and provides a platform to adjust the patient's treatment.

Abstract: A method and a system for refreshing addresses are disclosed. Said method includes: when state switching between a link fault and a fault recovery occurs in a link, a node where a port related to this link is situated refreshing an address forwarding list, and configuring a flag PF for suspending an operation of refreshing an address forwarding list on other ports of this node, and sending protocol message with address refreshing information to other nodes; and when ports of other nodes receive said protocol message, refreshing the address forwarding list only when identifier information included in this protocol message is inconsistent with identifier information stored in this port and this port is not configured with said PF flag. Said method and system judge whether to refresh the address forwarding list according to said PF flag, and determine whether to refresh the address forwarding list according to the judgment result.

Abstract: A method and a system for preventing a network storm from presenting in a multi-ring Ethernet, the method comprises: when a link in the multi-ring Ethernet is failed, at most one ring protecting link is unblocked, the ring protecting link and the failed link being in a same logic area. Wherein each link in the multi-ring Ethernet belongs uniquely to one logic area, when a link in the multi-ring Ethernet is failed, a master node of a logic area to which the failed link belongs unblocks a ring protecting link; or each link in the multi-ring Ethernet respectively belongs to one or more logic areas, each logic area is set with a priority, when a link in the multi-ring Ethernet is failed, the ring protecting link of one logic area which contains the failed link and has a highest priority is unblocked by the master node of the logic area.

Abstract: A method and a system for refreshing addresses are disclosed. Said method includes: when state switching between a link fault and a fault recovery occurs in a link, a node where a port related to this link is situated refreshing an address forwarding list, and configuring a flag PF for suspending an operation of refreshing an address forwarding list on other ports of this node, and sending protocol message with address refreshing information to other nodes; and when ports of other nodes receive said protocol message, refreshing the address forwarding list only when identifier information included in this protocol message is inconsistent with identifier information stored in this port and this port is not configured with said PF flag. Said method and system judge whether to refresh the address forwarding list according to said PF flag, and determine whether to refresh the address forwarding list according to the judgment result.

Abstract: The invention provides a network protection method and a network protection architecture. In a network, one or more protected local networks are determined according to practical situations and a protection characteristic set of the local network is set; a link in the protected links of the protection characteristic is set as a protection link; and whether a protection switching request exists is judged, if the protection switching request does not exist, a node to which the protection link belongs blocks a port connected with the protection link; and if the protection switching request exists, a node of the protection switching request blocks a designated port of the protection switching request, and the node to which the protection link belongs unblocks the port connected with the protection link.

Abstract: An implementation method for a protocol channel in Ethernet protection, and the method comprises: setting a block point of the protocol channel in Ethernet protection domain; in the protection domain, the protocol channel maintaining unblocked or maintaining unblocked or blocked synchronously with protected data channel in the protection domain depending on the type of the block point.

Abstract: Power consumption of an appliance under remote control is minimized. The appliance receives a wireless energy burst having a wireless magnetic resonating power coupling characteristic transmitted by a remote control device. The appliance is powered up from a powered-down state to a standby mode if the appliance is in the powered-down state when the wireless energy burst is received and the energy burst is of sufficient energy to activate a switched mode power supply of the appliance.

Abstract: A method and a system for preventing a network storm from presenting in a multi-ring Ethernet, the method comprises: when a link in the multi-ring Ethernet is failed, at most one ring protecting link is unblocked, the ring protecting link and the failed link being in a same logic area. Wherein each link in the multi-ring Ethernet belongs uniquely to one logic area, when a link in the multi-ring Ethernet is failed, a master node of a logic area to which the failed link belongs unblocks a ring protecting link; or each link in the multi-ring Ethernet respectively belongs to one or more logic areas, each logic area is set with a priority, when a link in the multi-ring Ethernet is failed, the ring protecting link of one logic area which contains the failed link and has a highest priority is unblocked by the master node of the logic area.

Abstract: A method and apparatus for updating inter-server communication software in a network are provided. More particularly, the invention is directed to a technique for software updating of servers that reduces the unavailability of network resources due to the update process. In this regard, the method includes the implementation of proxy software in servers that are to be updated. The servers are then selectively updated (e.g. one server at a time) in a manner, using the proxy software, to allow the servers to communicate with one another during the entire update process.

Abstract: A method and apparatus for updating inter-server communication software in a network are provided. More particularly, the invention is directed to a technique for software updating of servers that reduces the unavailability of network resources due to the update process. In this regard, the method includes the implementation of proxy software in servers that are to be updated. The servers are then selectively updated (e.g. one server at a time) in a manner, using the proxy software, to allow the servers to communicate with one another during the entire update process.

Abstract: A corrosion-resistant coating for a substrate is described. The corrosion-resistant coating comprises a first distinct layer of a first composition disposed over the substrate, wherein the first distinct layer has a thickness that is not greater than about 10 microns, and a second distinct layer of a second composition disposed over the first distinct layer, wherein the second distinct layer has a thickness that is not greater than about 10 microns and either the first distinct layer or the second distinct layer is corrosion-resistant. Preferably, the thickness of each distinct layer is less than about 1 or 2 microns, more preferably, less than about 0.4 microns. The coating may comprise additional layers. Corrosion-resistant articles, methods of protecting an articles, and methods of depositing corrosion-resistant coatings are also described.

Abstract: A corrosion-resistant coating for a substrate is described. The corrosion-resistant coating comprises a first distinct layer of a first composition disposed over the substrate, wherein the first distinct layer has a thickness that is not greater than about 10 microns, and a second distinct layer of a second composition disposed over the first distinct layer, wherein the second distinct layer has a thickness that is not greater than about 10 microns and either the first distinct layer or the second distinct layer is corrosion-resistant. Preferably, the thickness of each distinct layer is less than about 1 or 2 microns, more preferably, less than about 0.4 microns. The coating may comprise additional layers. Corrosion-resistant articles, methods of protecting an articles, and methods of depositing corrosion-resistant coatings are also described.

Abstract: Precursor solutions are provided to produce thin film resistive materials by combustion chemical vapor deposition (CCVD) or controlled atmosphere combustion chemical vapor deposition (CACCVD). The resistive material may be a mixture of a zero valence metal and a dielectric material, or the resistive materials may be a conductive oxide.

Abstract: A method for applying coatings to substrates using combustion chemical vapor deposition by mixing together a reagent and a carrier solution to form a reagent mixture, igniting the reagent mixture to create a flame, or flowing the reagent mixture through a plasma torch, in which the reagent is at least partially vaporized into a vapor phase, and contacting the vapor phase of the reagent to a substrate resulting in the deposition, at least in part from the vapor phase, of a coating of the reagent which can be controlled so as to have a preferred orientation on the substrate, and an apparatus to accomplish this method. This process can be used to deposit thin phosphate films and coatings.