Patents by Inventor Hong Shao

Hong Shao has filed for patents to protect the following inventions. This listing includes patent applications that are pending as well as patents that have already been granted by the United States Patent and Trademark Office (USPTO).

  • Patent number: 10478849
    Abstract: A nozzle auto-cleaning device and a nozzle auto-cleaning method are disclosed. The nozzle auto-cleaning device includes a base and a cleaning piece feeding unit disposed on the base, the base has a bearing surface on which the cleaning piece feeding unit is disposed, the cleaning piece feeding unit is configured to transport a cleaning piece installed inside the nozzle auto-cleaning device along a first direction intersected with the bearing surface so that a first portion of the cleaning piece is protruded in a direction away from the bearing surface and inserted into a nozzle, and the base is configured to move along at least one direction of the first direction, as well as a second direction and a third direction intersected in a plane of the bearing surface, so as to drive the first portion of the cleaning piece to move inside the nozzle.
    Type: Grant
    Filed: May 5, 2017
    Date of Patent: November 19, 2019
    Assignees: BOE Technology Group Co., Ltd., Hefei Xinsheng Optoelectronics Technology Co., Ltd.
    Inventors: Chen Yuan, Wei Zhou, Cheng Nan Hsieh, Yu Yang, Giseub Lim, Liang Yao, Hong Shao
  • Patent number: 10357818
    Abstract: A reusable casting head device comprises a casting head control mechanism, a casting head mechanism and a temperature control mechanism. A gate of the casting head is sealed by the gate holder to allow that initially heated molten aluminum is rapidly heated in the casting head, thus improving efficiency; the casting head made of beryllium copper is heated and maintained by the high-frequency heating ring, thus providing a high accuracy of temperature measurement and control; and the rotating cylinder, the positioning cylinder and the reverse rotating cylinder are employed for procedure operation to intelligentize the casting operation, thus providing low production cost.
    Type: Grant
    Filed: March 28, 2016
    Date of Patent: July 23, 2019
    Assignee: WUXI LIHU CORPORATION LIMITED
    Inventors: Hong Shao, Xinxiao Lu, Zhen Zhu
  • Publication number: 20180229257
    Abstract: A nozzle auto-cleaning device and a nozzle auto-cleaning method are disclosed. The nozzle auto-cleaning device includes a base and a cleaning piece feeding unit disposed on the base, the base has a bearing surface on which the cleaning piece feeding unit is disposed, the cleaning piece feeding unit is configured to transport a cleaning piece installed inside the nozzle auto-cleaning device along a first direction intersected with the bearing surface so that a first portion of the cleaning piece is protruded in a direction away from the bearing surface and inserted into a nozzle, and the base is configured to move along at least one direction of the first direction, as well as a second direction and a third direction intersected in a plane of the bearing surface, so as to drive the first portion of the cleaning piece to move inside the nozzle.
    Type: Application
    Filed: May 5, 2017
    Publication date: August 16, 2018
    Applicants: BOE Technology Group Co., Ltd., Hefei Xinsheng Optoelectronics Technology Co., Ltd.
    Inventors: Chen Yuan, Wei Zhou, Cheng Nan Hsieh, Yu Yang, Giseub LIM, Liang Yao, Hong Shao
  • Publication number: 20180071815
    Abstract: A reusable casting head device comprises a casting head control mechanism, a casting head mechanism and a temperature control mechanism. A gate of the casting head is sealed by the gate holder to allow that initially heated molten aluminum is rapidly heated in the casting head, thus improving efficiency; the casting head made of beryllium copper is heated and maintained by the high-frequency heating ring, thus providing a high accuracy of temperature measurement and control; and the rotating cylinder, the positioning cylinder and the reverse rotating cylinder are employed for procedure operation to intelligentize the casting operation, thus providing low production cost.
    Type: Application
    Filed: March 28, 2016
    Publication date: March 15, 2018
    Inventors: Hong SHAO, Xinxiao LU, Zhen ZHU
  • Publication number: 20160369341
    Abstract: The present invention relates to a rs6311 test kit, which includes a probe, a primer, and a polymerase chain reaction solution, wherein said probe sequence is as follows: rs6311T-fam: CTGTGAGTGTCTGGC (SEQ. ID. NO. 1) and rs6311C-vic: CTGTGAGTGTCCGGC (SEQ. ID. NO. 2); and said primer sequence is as follows: rs6311-F: AGAGAGAACATAAATAAGGCTAGAAAACAGTA (SEQ. ID. NO. 3) and rs6311-R: CACTGTTGGCTTTGGATGGA (SEQ. ID. NO. 4). The test kit is used to determine genotype of a depression patient, in order to treat the depression patient with a combination of serotonin reuptake inhibitors (SSRI) and low dose risperidone. The actual dose of risperidone and the ratio between SSRIs and risperidone is determined by the genotype of the depression patient. The present invention determines human drug metabolism rate through a single nucleotide polymorphism and provides a platform to adjust the patient's treatment.
    Type: Application
    Filed: December 16, 2015
    Publication date: December 22, 2016
    Inventors: Wen E, Qingmei Kong, Xiaojing Zhang, Hong Shao, Zhenguo Zhao, Shuping Liu, Maomao Li, Xinxia Tian
  • Publication number: 20140162261
    Abstract: The present invention relates to a rs6311 test kit, which includes a probe, a primer, and a polymerase chain reaction solution, wherein said probe sequence is as follows: rs6311T-fam: CTGTGAGTGTCTGGC (SEQ. ID. NO. 1) and rs6311C-vic: CTGTGAGTGTCCGGC (SEQ. ID. NO. 2); and said primer sequence is as follows: rs6311-F: AGAGAGAACATAAATAAGGCTAGAAAACAGTA (SEQ. ID. NO. 3) and rs6311-R: CACTGTTGGCTTTGGATGGA (SEQ. ID. NO. 4). The test kit is used to determine genotype of a depression patient, in order to treat the depression patient with a combination of serotonin reuptake inhibitors (SSRI) and low dose risperidone. The actual dose of risperidone and the ratio between SSRIs and risperidone is determined by the genotype of the depression patient. The present invention determines human drug metabolism rate through a single nucleotide polymorphism and provides a platform to adjust the patient's treatment.
    Type: Application
    Filed: November 27, 2013
    Publication date: June 12, 2014
    Inventors: Wen E., Qingmei Kong, Xiaojing Zhang, Hong Shao, Zhenguo Zhao, Shuping Liu, Maomao Li, Xinxia Tian
  • Patent number: 8681604
    Abstract: A method and a system for refreshing addresses are disclosed. Said method includes: when state switching between a link fault and a fault recovery occurs in a link, a node where a port related to this link is situated refreshing an address forwarding list, and configuring a flag PF for suspending an operation of refreshing an address forwarding list on other ports of this node, and sending protocol message with address refreshing information to other nodes; and when ports of other nodes receive said protocol message, refreshing the address forwarding list only when identifier information included in this protocol message is inconsistent with identifier information stored in this port and this port is not configured with said PF flag. Said method and system judge whether to refresh the address forwarding list according to said PF flag, and determine whether to refresh the address forwarding list according to the judgment result.
    Type: Grant
    Filed: December 24, 2009
    Date of Patent: March 25, 2014
    Assignee: ZTE Corporation
    Inventors: Bin Wang, Hong Shao, Shaoyong Wu
  • Patent number: 8565072
    Abstract: A method and a system for preventing a network storm from presenting in a multi-ring Ethernet, the method comprises: when a link in the multi-ring Ethernet is failed, at most one ring protecting link is unblocked, the ring protecting link and the failed link being in a same logic area. Wherein each link in the multi-ring Ethernet belongs uniquely to one logic area, when a link in the multi-ring Ethernet is failed, a master node of a logic area to which the failed link belongs unblocks a ring protecting link; or each link in the multi-ring Ethernet respectively belongs to one or more logic areas, each logic area is set with a priority, when a link in the multi-ring Ethernet is failed, the ring protecting link of one logic area which contains the failed link and has a highest priority is unblocked by the master node of the logic area.
    Type: Grant
    Filed: January 5, 2009
    Date of Patent: October 22, 2013
    Assignee: ZTE Corporation
    Inventors: Shaoyong Wu, Hong Shao, Tao Zhang
  • Publication number: 20120087233
    Abstract: A method and a system for refreshing addresses are disclosed. Said method includes: when state switching between a link fault and a fault recovery occurs in a link, a node where a port related to this link is situated refreshing an address forwarding list, and configuring a flag PF for suspending an operation of refreshing an address forwarding list on other ports of this node, and sending protocol message with address refreshing information to other nodes; and when ports of other nodes receive said protocol message, refreshing the address forwarding list only when identifier information included in this protocol message is inconsistent with identifier information stored in this port and this port is not configured with said PF flag. Said method and system judge whether to refresh the address forwarding list according to said PF flag, and determine whether to refresh the address forwarding list according to the judgment result.
    Type: Application
    Filed: December 24, 2009
    Publication date: April 12, 2012
    Inventors: Bin Wang, Hong Shao, Shaoyong Wu
  • Publication number: 20120087277
    Abstract: The invention provides a network protection method and a network protection architecture. In a network, one or more protected local networks are determined according to practical situations and a protection characteristic set of the local network is set; a link in the protected links of the protection characteristic is set as a protection link; and whether a protection switching request exists is judged, if the protection switching request does not exist, a node to which the protection link belongs blocks a port connected with the protection link; and if the protection switching request exists, a node of the protection switching request blocks a designated port of the protection switching request, and the node to which the protection link belongs unblocks the port connected with the protection link.
    Type: Application
    Filed: December 15, 2009
    Publication date: April 12, 2012
    Inventors: Shaoyong Wu, Hong Shao
  • Publication number: 20110299388
    Abstract: An implementation method for a protocol channel in Ethernet protection, and the method comprises: setting a block point of the protocol channel in Ethernet protection domain; in the protection domain, the protocol channel maintaining unblocked or maintaining unblocked or blocked synchronously with protected data channel in the protection domain depending on the type of the block point.
    Type: Application
    Filed: October 23, 2009
    Publication date: December 8, 2011
    Inventors: Shaoyong Wu, Jian Yang, Hong Shao
  • Publication number: 20110221580
    Abstract: Power consumption of an appliance under remote control is minimized. The appliance receives a wireless energy burst having a wireless magnetic resonating power coupling characteristic transmitted by a remote control device. The appliance is powered up from a powered-down state to a standby mode if the appliance is in the powered-down state when the wireless energy burst is received and the energy burst is of sufficient energy to activate a switched mode power supply of the appliance.
    Type: Application
    Filed: March 12, 2010
    Publication date: September 15, 2011
    Applicants: STMicroelectronics Asia Pacific PTE, Ltd., STMicroelectronics KK
    Inventors: Sebastien Marsanne, Francesco Doddo, Hong-Shao Chen, Romel Estomata
  • Publication number: 20110116365
    Abstract: A method and a system for preventing a network storm from presenting in a multi-ring Ethernet, the method comprises: when a link in the multi-ring Ethernet is failed, at most one ring protecting link is unblocked, the ring protecting link and the failed link being in a same logic area. Wherein each link in the multi-ring Ethernet belongs uniquely to one logic area, when a link in the multi-ring Ethernet is failed, a master node of a logic area to which the failed link belongs unblocks a ring protecting link; or each link in the multi-ring Ethernet respectively belongs to one or more logic areas, each logic area is set with a priority, when a link in the multi-ring Ethernet is failed, the ring protecting link of one logic area which contains the failed link and has a highest priority is unblocked by the master node of the logic area.
    Type: Application
    Filed: January 5, 2009
    Publication date: May 19, 2011
    Applicant: ZTE CORPORATION
    Inventors: Shaoyong Wu, Hong Shao, Tao Zhang
  • Patent number: 7228539
    Abstract: A method and apparatus for updating inter-server communication software in a network are provided. More particularly, the invention is directed to a technique for software updating of servers that reduces the unavailability of network resources due to the update process. In this regard, the method includes the implementation of proxy software in servers that are to be updated. The servers are then selectively updated (e.g. one server at a time) in a manner, using the proxy software, to allow the servers to communicate with one another during the entire update process.
    Type: Grant
    Filed: June 16, 2003
    Date of Patent: June 5, 2007
    Assignee: Lucent Technologies Inc.
    Inventors: Ruihua Zhang, Hong Shao
  • Publication number: 20040255287
    Abstract: A method and apparatus for updating inter-server communication software in a network are provided. More particularly, the invention is directed to a technique for software updating of servers that reduces the unavailability of network resources due to the update process. In this regard, the method includes the implementation of proxy software in servers that are to be updated. The servers are then selectively updated (e.g. one server at a time) in a manner, using the proxy software, to allow the servers to communicate with one another during the entire update process.
    Type: Application
    Filed: June 16, 2003
    Publication date: December 16, 2004
    Inventors: Ruihua Zhang, Hong Shao
  • Patent number: 6416870
    Abstract: A corrosion-resistant coating for a substrate is described. The corrosion-resistant coating comprises a first distinct layer of a first composition disposed over the substrate, wherein the first distinct layer has a thickness that is not greater than about 10 microns, and a second distinct layer of a second composition disposed over the first distinct layer, wherein the second distinct layer has a thickness that is not greater than about 10 microns and either the first distinct layer or the second distinct layer is corrosion-resistant. Preferably, the thickness of each distinct layer is less than about 1 or 2 microns, more preferably, less than about 0.4 microns. The coating may comprise additional layers. Corrosion-resistant articles, methods of protecting an articles, and methods of depositing corrosion-resistant coatings are also described.
    Type: Grant
    Filed: July 28, 2000
    Date of Patent: July 9, 2002
    Assignee: MicroCoating Technologies, Inc.
    Inventors: Andrew Tye Hunt, Tzyy Jiuan Hwang, Michelle R. Hendrick, Hong Shao, Joseph R. Thomas
  • Patent number: 6214473
    Abstract: A corrosion-resistant coating for a substrate is described. The corrosion-resistant coating comprises a first distinct layer of a first composition disposed over the substrate, wherein the first distinct layer has a thickness that is not greater than about 10 microns, and a second distinct layer of a second composition disposed over the first distinct layer, wherein the second distinct layer has a thickness that is not greater than about 10 microns and either the first distinct layer or the second distinct layer is corrosion-resistant. Preferably, the thickness of each distinct layer is less than about 1 or 2 microns, more preferably, less than about 0.4 microns. The coating may comprise additional layers. Corrosion-resistant articles, methods of protecting an articles, and methods of depositing corrosion-resistant coatings are also described.
    Type: Grant
    Filed: May 13, 1998
    Date of Patent: April 10, 2001
    Inventors: Andrew Tye Hunt, Tzyy Jiuan Hwang, Michelle R. Hendrick, Hong Shao, Joseph R. Thomas
  • Patent number: 6193911
    Abstract: Precursor solutions are provided to produce thin film resistive materials by combustion chemical vapor deposition (CCVD) or controlled atmosphere combustion chemical vapor deposition (CACCVD). The resistive material may be a mixture of a zero valence metal and a dielectric material, or the resistive materials may be a conductive oxide.
    Type: Grant
    Filed: April 29, 1998
    Date of Patent: February 27, 2001
    Assignee: Morton International Incorporated
    Inventors: Andrew T. Hunt, Tzyy Jiuan Hwang, Helmut G. Hornis, Hong Shao, Joe Thomas, Wen-Yi Lin, Shara S. Shoup, Henry A. Luten, John Eric McEntyre
  • Patent number: 5858465
    Abstract: A method for applying coatings to substrates using combustion chemical vapor deposition by mixing together a reagent and a carrier solution to form a reagent mixture, igniting the reagent mixture to create a flame, or flowing the reagent mixture through a plasma torch, in which the reagent is at least partially vaporized into a vapor phase, and contacting the vapor phase of the reagent to a substrate resulting in the deposition, at least in part from the vapor phase, of a coating of the reagent which can be controlled so as to have a preferred orientation on the substrate, and an apparatus to accomplish this method. This process can be used to deposit thin phosphate films and coatings.
    Type: Grant
    Filed: September 8, 1997
    Date of Patent: January 12, 1999
    Assignee: Georgia Tech Research Corporation
    Inventors: Andrew Tye Hunt, Tzyy-Jiuan Hwang, Hong Shao