Abstract: The present disclosure provides use of Clostridium ghonii combined with a tumor angiogenesis inhibitor in preparing a pharmaceutical product for treating a tumor. The present disclosure further provides a drug for treating a tumor, where the drug includes active ingredients of Clostridium ghonii and a tumor angiogenesis inhibitor.

Abstract: The present invention provides a joint optimization method and system for delay and spectrum occupation in a cloud-edge collaborative network. The method includes: initializing a cloud-edge collaborative network, and generating a set of user requests; establishing a target function of minimum average end-to-end delay and minimum spectrum slot occupation of a user request; during processing of each user request based on the target function, sequentially determining whether a node and path selection uniqueness constraint, a mobile edge computing (MEC) server load constraint, a spectrum resource occupation and uniqueness constraint, a spectrum continuity constraint, and a spectrum consistency constraint are satisfied, where if all constraints are satisfied, the user request is successfully processed, and the process turns to step S4; or if any constraint is not satisfied, the user request fails to be processed; and calculating average end-to-end delay and spectrum resource occupancy of the user request.

Abstract: The present disclosure relates to use of a Clostridium ghonii spore combined with pembrolizumab in cancer treatment. It is found for the first time that the Clostridium ghonii spore combined with pembrolizumab can significantly improve a curative effect of colon cancer and reduce a dose of the pembrolizumab, and thus is efficient and low-toxic. Oncolysis by Clostridium ghonii can affect immunogenicity of a tumor microenvironment (TME) by various ways, converts an immunosuppressive state of the TME into an immune-activated state, adjusts the immunosuppressive TME, and breaks an immune tolerance. An optimal combination of the Clostridium ghonii spore and the pembrolizumab thoroughly removes about 20% of mouse tumor tissues. A benefit range of patients with tumors treated by a PD-1 antibody is expanded. The combination even has an obvious curative effect on patients failed the treatment by the PD-1 antibody.

Abstract: The present application discloses a communication method, a terminal, a server, a communication system, a computer device and a medium. The communication method includes that a server establishes a connection and feeds back a display control in response to requests of a first terminal and a second terminal; then, the server feeds back function feedback information in response to a function request of the first terminal, and feeds back function feedback information in response to a menu request of the second terminal; and the servers presents multiple interface components and maintains and updates each interface component in response to management operation of a third user.

Abstract: A nozzle auto-cleaning device and a nozzle auto-cleaning method are disclosed. The nozzle auto-cleaning device includes a base and a cleaning piece feeding unit disposed on the base, the base has a bearing surface on which the cleaning piece feeding unit is disposed, the cleaning piece feeding unit is configured to transport a cleaning piece installed inside the nozzle auto-cleaning device along a first direction intersected with the bearing surface so that a first portion of the cleaning piece is protruded in a direction away from the bearing surface and inserted into a nozzle, and the base is configured to move along at least one direction of the first direction, as well as a second direction and a third direction intersected in a plane of the bearing surface, so as to drive the first portion of the cleaning piece to move inside the nozzle.

Abstract: A reusable casting head device comprises a casting head control mechanism, a casting head mechanism and a temperature control mechanism. A gate of the casting head is sealed by the gate holder to allow that initially heated molten aluminum is rapidly heated in the casting head, thus improving efficiency; the casting head made of beryllium copper is heated and maintained by the high-frequency heating ring, thus providing a high accuracy of temperature measurement and control; and the rotating cylinder, the positioning cylinder and the reverse rotating cylinder are employed for procedure operation to intelligentize the casting operation, thus providing low production cost.

Abstract: A nozzle auto-cleaning device and a nozzle auto-cleaning method are disclosed. The nozzle auto-cleaning device includes a base and a cleaning piece feeding unit disposed on the base, the base has a bearing surface on which the cleaning piece feeding unit is disposed, the cleaning piece feeding unit is configured to transport a cleaning piece installed inside the nozzle auto-cleaning device along a first direction intersected with the bearing surface so that a first portion of the cleaning piece is protruded in a direction away from the bearing surface and inserted into a nozzle, and the base is configured to move along at least one direction of the first direction, as well as a second direction and a third direction intersected in a plane of the bearing surface, so as to drive the first portion of the cleaning piece to move inside the nozzle.

Abstract: A reusable casting head device comprises a casting head control mechanism, a casting head mechanism and a temperature control mechanism. A gate of the casting head is sealed by the gate holder to allow that initially heated molten aluminum is rapidly heated in the casting head, thus improving efficiency; the casting head made of beryllium copper is heated and maintained by the high-frequency heating ring, thus providing a high accuracy of temperature measurement and control; and the rotating cylinder, the positioning cylinder and the reverse rotating cylinder are employed for procedure operation to intelligentize the casting operation, thus providing low production cost.

Abstract: The present invention relates to a rs6311 test kit, which includes a probe, a primer, and a polymerase chain reaction solution, wherein said probe sequence is as follows: rs6311T-fam: CTGTGAGTGTCTGGC (SEQ. ID. NO. 1) and rs6311C-vic: CTGTGAGTGTCCGGC (SEQ. ID. NO. 2); and said primer sequence is as follows: rs6311-F: AGAGAGAACATAAATAAGGCTAGAAAACAGTA (SEQ. ID. NO. 3) and rs6311-R: CACTGTTGGCTTTGGATGGA (SEQ. ID. NO. 4). The test kit is used to determine genotype of a depression patient, in order to treat the depression patient with a combination of serotonin reuptake inhibitors (SSRI) and low dose risperidone. The actual dose of risperidone and the ratio between SSRIs and risperidone is determined by the genotype of the depression patient. The present invention determines human drug metabolism rate through a single nucleotide polymorphism and provides a platform to adjust the patient's treatment.

Abstract: The present invention relates to a rs6311 test kit, which includes a probe, a primer, and a polymerase chain reaction solution, wherein said probe sequence is as follows: rs6311T-fam: CTGTGAGTGTCTGGC (SEQ. ID. NO. 1) and rs6311C-vic: CTGTGAGTGTCCGGC (SEQ. ID. NO. 2); and said primer sequence is as follows: rs6311-F: AGAGAGAACATAAATAAGGCTAGAAAACAGTA (SEQ. ID. NO. 3) and rs6311-R: CACTGTTGGCTTTGGATGGA (SEQ. ID. NO. 4). The test kit is used to determine genotype of a depression patient, in order to treat the depression patient with a combination of serotonin reuptake inhibitors (SSRI) and low dose risperidone. The actual dose of risperidone and the ratio between SSRIs and risperidone is determined by the genotype of the depression patient. The present invention determines human drug metabolism rate through a single nucleotide polymorphism and provides a platform to adjust the patient's treatment.

Abstract: A method and a system for refreshing addresses are disclosed. Said method includes: when state switching between a link fault and a fault recovery occurs in a link, a node where a port related to this link is situated refreshing an address forwarding list, and configuring a flag PF for suspending an operation of refreshing an address forwarding list on other ports of this node, and sending protocol message with address refreshing information to other nodes; and when ports of other nodes receive said protocol message, refreshing the address forwarding list only when identifier information included in this protocol message is inconsistent with identifier information stored in this port and this port is not configured with said PF flag. Said method and system judge whether to refresh the address forwarding list according to said PF flag, and determine whether to refresh the address forwarding list according to the judgment result.

Abstract: A method and a system for preventing a network storm from presenting in a multi-ring Ethernet, the method comprises: when a link in the multi-ring Ethernet is failed, at most one ring protecting link is unblocked, the ring protecting link and the failed link being in a same logic area. Wherein each link in the multi-ring Ethernet belongs uniquely to one logic area, when a link in the multi-ring Ethernet is failed, a master node of a logic area to which the failed link belongs unblocks a ring protecting link; or each link in the multi-ring Ethernet respectively belongs to one or more logic areas, each logic area is set with a priority, when a link in the multi-ring Ethernet is failed, the ring protecting link of one logic area which contains the failed link and has a highest priority is unblocked by the master node of the logic area.

Abstract: The invention provides a network protection method and a network protection architecture. In a network, one or more protected local networks are determined according to practical situations and a protection characteristic set of the local network is set; a link in the protected links of the protection characteristic is set as a protection link; and whether a protection switching request exists is judged, if the protection switching request does not exist, a node to which the protection link belongs blocks a port connected with the protection link; and if the protection switching request exists, a node of the protection switching request blocks a designated port of the protection switching request, and the node to which the protection link belongs unblocks the port connected with the protection link.

Abstract: A method and a system for refreshing addresses are disclosed. Said method includes: when state switching between a link fault and a fault recovery occurs in a link, a node where a port related to this link is situated refreshing an address forwarding list, and configuring a flag PF for suspending an operation of refreshing an address forwarding list on other ports of this node, and sending protocol message with address refreshing information to other nodes; and when ports of other nodes receive said protocol message, refreshing the address forwarding list only when identifier information included in this protocol message is inconsistent with identifier information stored in this port and this port is not configured with said PF flag. Said method and system judge whether to refresh the address forwarding list according to said PF flag, and determine whether to refresh the address forwarding list according to the judgment result.

Abstract: An implementation method for a protocol channel in Ethernet protection, and the method comprises: setting a block point of the protocol channel in Ethernet protection domain; in the protection domain, the protocol channel maintaining unblocked or maintaining unblocked or blocked synchronously with protected data channel in the protection domain depending on the type of the block point.

Abstract: Power consumption of an appliance under remote control is minimized. The appliance receives a wireless energy burst having a wireless magnetic resonating power coupling characteristic transmitted by a remote control device. The appliance is powered up from a powered-down state to a standby mode if the appliance is in the powered-down state when the wireless energy burst is received and the energy burst is of sufficient energy to activate a switched mode power supply of the appliance.

Abstract: A method and a system for preventing a network storm from presenting in a multi-ring Ethernet, the method comprises: when a link in the multi-ring Ethernet is failed, at most one ring protecting link is unblocked, the ring protecting link and the failed link being in a same logic area. Wherein each link in the multi-ring Ethernet belongs uniquely to one logic area, when a link in the multi-ring Ethernet is failed, a master node of a logic area to which the failed link belongs unblocks a ring protecting link; or each link in the multi-ring Ethernet respectively belongs to one or more logic areas, each logic area is set with a priority, when a link in the multi-ring Ethernet is failed, the ring protecting link of one logic area which contains the failed link and has a highest priority is unblocked by the master node of the logic area.

Abstract: A method and apparatus for updating inter-server communication software in a network are provided. More particularly, the invention is directed to a technique for software updating of servers that reduces the unavailability of network resources due to the update process. In this regard, the method includes the implementation of proxy software in servers that are to be updated. The servers are then selectively updated (e.g. one server at a time) in a manner, using the proxy software, to allow the servers to communicate with one another during the entire update process.

Abstract: A method and apparatus for updating inter-server communication software in a network are provided. More particularly, the invention is directed to a technique for software updating of servers that reduces the unavailability of network resources due to the update process. In this regard, the method includes the implementation of proxy software in servers that are to be updated. The servers are then selectively updated (e.g. one server at a time) in a manner, using the proxy software, to allow the servers to communicate with one another during the entire update process.

Abstract: A corrosion-resistant coating for a substrate is described. The corrosion-resistant coating comprises a first distinct layer of a first composition disposed over the substrate, wherein the first distinct layer has a thickness that is not greater than about 10 microns, and a second distinct layer of a second composition disposed over the first distinct layer, wherein the second distinct layer has a thickness that is not greater than about 10 microns and either the first distinct layer or the second distinct layer is corrosion-resistant. Preferably, the thickness of each distinct layer is less than about 1 or 2 microns, more preferably, less than about 0.4 microns. The coating may comprise additional layers. Corrosion-resistant articles, methods of protecting an articles, and methods of depositing corrosion-resistant coatings are also described.