Abstract: The present invention provides a composition for use in treating or preventing neoplasia, comprising an effective actein. The present invention also provides a composition for use in treating or preventing neoplasia, comprising an effective anti-neoplastic amount of an ethyl acetate extract of black cohosh. The present invention further provides a combination of anti-neoplastic agents, comprising an effective anti-neoplastic amount of an ethyl acetate extract of black cohosh and an effective anti-neoplastic amount of at least one additional chemopreventive or chemotherapeutic agent. Methods for treating and preventing neoplasia are also provided.

Abstract: A method for treating, preventing or ameliorating breast cancer is provided by administering a synergistic amount of digitoxin and either actein or an extract of black cohosh comprising triterpene glycosides, and optionally another chemopreventive agent which may be paclitaxel. Methods for treating or preventing a neoplasia using a synergistic combination, and compositions of a synergistic combination of a cardiac glycoside and either actein or an extract of black cohosh comprising triterpene glycosides, and optionally another chemopreventive agent which may be a taxane are also provided. The compositions may also be used in a method for modulating Na+K+ATPase activity. In addition, a method for inhibiting the progression or development of breast cancer in vivo by administering either actein or an extract of black cohosh comprising triterpene glycosides and optionally at least one other chemoprotective agent is provided.

Abstract: A method is provided for treating, preventing or ameliorating neoplasia in a subject. This method includes administering to the subject an amount of actein or an amount of an extract of black cohosh that contains a triterpene glycoside, which amount of the actein or black cohosh is effective to treat, prevent or ameliorate the neoplasia, in combination with an amount of a statin which is effective to treat, prevent, or ameliorate the neoplasia. Related methods for treating, preventing or ameliorating breast cancer, or liver cell neoplasia are also provided. In addition, methods for modulating a cholesterol biosynthesis pathway and a stress response pathway in a subject are provided. These methods include administering to a subject a composition comprising an anti-neoplastic synergistic amount of a statin and actein. Compositions for carrying out such methods are also provided.

Abstract: The present invention provides a composition for use in treating or preventing neoplasia, comprising an effective actein. The present invention also provides a composition for use in treating or preventing neoplasia, comprising an effective anti-neoplastic amount of an ethyl acetate extract of black cohosh. The present invention further provides a combination of anti-neoplastic agents, comprising an effective anti-neoplastic amount of an ethyl acetate extract of black cohosh and an effective anti-neoplastic amount of at least one additional chemopreventive or chemotherapeutic agent. Methods for treating and preventing neoplasia are also provided.

Abstract: A method is provided for treating, preventing or ameliorating neoplasia in a subject. This method includes administering to the subject an amount of actein or an amount of an extract of black cohosh that contains a triterpene glycoside, which amount of the actein or black cohosh is effective to treat, prevent or ameliorate the neoplasia, in combination with an amount of a statin which is effective to treat, prevent, or ameliorate the neoplasia. Related methods for treating, preventing or ameliorating breast cancer, or liver cell neoplasia are also provided. In addition, methods for modulating a cholesterol biosynthesis pathway and a stress response pathway in a subject are provided. These methods include administering to a subject a composition comprising an anti-neoplastic synergistic amount of a statin and actein. Compositions for carrying out such methods are also provided.

Abstract: A method for treating, preventing or ameliorating breast cancer is provided by administering a synergistic amount of digitoxin and either actein or an extract of black cohosh comprising triterpene glycosides, and optionally another chemopreventive agent which may be paclitaxel. Methods for treating or preventing a neoplasia using a synergistic combination, and compositions of a synergistic combination of a cardiac glycoside and either actein or an extract of black cohosh comprising triterpene glycosides, and optionally another chemopreventive agent which may be a taxane are also provided. The compositions may also be used in a method for modulating Na+K+ATPase activity. In addition, a method for inhibiting the progression or development of breast cancer in vivo by administering either actein or an extract of black cohosh comprising triterpene glycosides and optionally at least one other chemoprotective agent is provided.

Abstract: The present invention provides a composition for use in treating or preventing neoplasia, comprising an effective actein. The present invention also provides a composition for use in treating or preventing neoplasia, comprising an effective anti-neoplastic amount of an ethyl acetate extract of black cohosh. The present invention further provides a combination of anti-neoplastic agents, comprising an effective anti-neoplastic amount of an ethyl acetate extract of black cohosh and an effective anti-neoplastic amount of at least one additional chemopreventive or chemotherapeutic agent. Methods for treating and preventing neoplasia are also provided.

Abstract: The present invention provides a composition for use in treating or preventing neoplasia, comprising an effective actein. The present invention also provides a composition for use in treating or preventing neoplasia, comprising an effective anti-neoplastic amount of an ethyl acetate extract of black cohosh. The present invention further provides a combination of anti-neoplastic agents, comprising an effective anti-neoplastic amount of an ethyl acetate extract of black cohosh and an effective anti-neoplastic amount of at least one additional chemopreventive or chemotherapeutic agent. Methods for treating and preventing neoplasia are also provided.

Abstract: This invention provides a method to identify compounds potentially useful for the treatment and prevention of neoplasia in mammals. The phosphodiesterase inhibitory activity of a compound is determined along with its ability to elevate JNK kinase activity. Growth inhibitory and apoptosis inducing effects on cultured tumor cells are also determined. Compounds that exhibit phosphodiesterase inhibition, an ability to elevate JNK kinase activity, growth inhibition and apoptosis induction are desirable for the treatment of neoplasia.

Abstract: Methods and compositions for the prevention and/or treatment of cardiovascular diseases, the methods comprising administering to individuals in need thereof, an effective amount of a non-steroidal anti-inflammatory drug alone or in combination with other conventional therapies to induce apoptosis, reduce proliferation, induce quiescence, inhibit cell migration, or influence cell differentiation of the cells in the vascular wall and or/induce hypolipidemia.

Abstract: A biologically pure culture of a microorganism is provided designated SH2A and deposited under ATCC Accession No. 55926, or a mutant derived therefrom. Further provided is a biologically pure culture of a microorganism designated SH2B and deposited under ATCC Accession No. 202050, or a mutant derived therefrom. A method of degrading an organic material is carried out by treating the organic material with an effective, degrading amount of either SH2A or a mutant derived therefrom, or SH2B or a mutant derived therefrom. The microorganism designated SH2A or a mutant derived therefrom, or SH2B or a mutant derived therefrom, is grown by culturing the microorganism at a temperature and in a medium effective to promote growth of the microorganism.

Abstract: This invention provides a DNA oligomer having the sequence 5'GGACATAGGCTGATCTCTTAGC3' (SEQ ID NO: 1) and which is complementary to Campylobacter pylori 16S ribosomal RNA sequences, for use as a probe to detect Campylobacter pylori.This invention also provides DNA oligomers having the sequences 5'GCGCAATCAGCGTCAGGTAATG3' (SEQ ID NO: 2) and 5'GCTAAGAGATCAGCCTATGTCCC3' (SEQ ID NO: 3) and which are complementary to certain Campylobacter pylori 16S ribosomal RNA sequences, for use as polymerase chain reaction primers for the detection of Campylobacter pylori.This invention also provides a method for producing species-specific bacterial or protozoan DNA oligomers encoding 16S ribosomal RNA by means of the polymerase chain reaction for use as species-specific probes and PCR primers, and methods for detection and identification of bacteria and protozoa.Further, this invention provides a DNA oligomer having the sequence 5'ACGGGCGGTGTGTGC3' (SEQ ID NO: 4).