Abstract: The present invention provides a prediction device, a prediction method, a program, and a recording medium, with which whether or not desired aptamer sequences are enriched can be predicted easily. The prediction device of the present invention 10 includes an input unit 11, a calculation unit 12, and a prediction unit 13. The input unit 11 is a unit through which sequence information on a target aptamer sequence group including selected aptamers in a target pool and a reference aptamer sequence group including reference aptamer sequences are inputted. The calculation unit 12 calculates the free energy of the target aptamer sequence group and the free energy of the reference aptamer sequence group. The prediction unit 13 compares the free energy of these sequence groups, and predicts that the target pool is an enriched pool when the free energy of the target aptamer sequence group is lower than the free energy of the reference aptamer sequence group.

Abstract: The invention provides a nucleic acid molecule having a binding affinity to a rodent-derived IgG antibody, which can be prepared easier than an antibody and has a binding affinity equivalent or superior to that of an antibody, a binder using the nucleic acid molecule, a detection reagent, and a detection kit. The nucleic acid molecule of the invention has a binding affinity to a rodent-derived IgG antibody and has a dissociation constant of 1 ?M or less. The binder for a rodent-derived IgG antibody of the present invention includes the nucleic acid molecule of the present invention. The detection reagent for detecting a rodent-derived IgG antibody of the invention includes the binder for a rodent-derived IgG antibody of the invention. The detection kit for detecting a rodent-derived IgG antibody of the invention includes the detection reagent for detecting a rodent-derived IgG antibody of the invention.

Abstract: The present invention provides a nucleic acid molecule having an ability to bind to a rabbit anti-mouse IgG antibody, which can be prepared more easily than an antibody and has a binding ability equal to or higher than that of an antibody. The nucleic acid molecule according to the present invention may have the sequences set forth in SEQ ID NOS: 1 to 5. The nucleic acid molecule according to the present invention may be a nucleic acid having an ability to bind to a rabbit IgG antibody, which substantially has homology to its sequence. The nucleic acid molecule according to the present invention may have a binding constant (KD) of 1.18×10?7 (M) or less to the rabbit IgG antibody.

Abstract: A nucleic acid molecule that can bind to HMGB1 protein and applications thereof are provided. A nucleic acid molecule having a dissociation constant for HMGB1 protein of 5×10?7 or less can be used as the nucleic acid molecule that can bind to HMGB1 protein. The HMGB1 binding nucleic acid molecule can bind to HMGB1 protein that is known to be a cause of diseases such as cancer and inflammation, and it is therefore possible to obtain an effect to prevent and an effect to treat such diseases by allowing the HMGB1 binding nucleic acid molecule to bind to HMGB1 protein in a living body.

Abstract: The technique by which simple analysis of an intended subject to be analyzed can be carried out is provided. In this technique, a nucleic acid element 16 for use in analysis including: a first nucleic acid part 12; and a second nucleic acid part 13 is used. In the nucleic acid element 16, the first nucleic acid part 12 is a binding part that can bind to a subject 11 to be analyzed, and the second nucleic acid part 13 is a labeling part that can distinguish between binding and non-binding of the first nucleic acid part 12 to the subject 11. It is preferred that the first nucleic acid part 12 is an aptamer against the subject 11. The subject 11 can be analyzed easily by using the nucleic acid element 16, binding the subject 11 to the first nucleic acid part 12, and then analyzing the binding with the second nucleic acid part 13.

Abstract: The present invention provides a process for generation of a transformed plant capable of emitting fluorescence by introducing a gene encoding a non-plant-derived fluorescent protein into a plant such that the fluorescent protein is recombinantly expressed in the active form of its mature protein in the leaf or petal of the plant, and also provides a transformed garden plant capable of emitting fluorescence that is generated by using the process. For example, cDNA encoding the full-length amino acid sequence of a Chiridius poppei-derived fluorescent protein CpYGFP or its H52F modified protein CpYGFP H52F is inserted into a T-DNA-based expression vector system, which is in turn introduced into the chromosomal DNA of a plant. As a result, the transformed plant thus generated can exhibit fluorescence attributed to these fluorescent proteins and exhibit no substantial difference in the other phenotypes from wild-type one of the plant.

Abstract: An aptamer capable of binding to a histidine peptide is provided.

Abstract: The present invention relates to a nucleic acid molecule capable of binding to a 2,4,6-trinitrophenyl skeleton, a method for detecting a compound having the 2,4,6-trinitrophenyl skeleton using the nucleic acid molecule, use of the nucleic acid molecule for detecting a compound having the 2,4,6-trinitrophenyl skeleton, and a method for detecting a compound having the 2,4,6-trinitrophenyl skeleton.

Abstract: The present invention provides a nucleic acid molecule having an ability to bind to a rabbit anti-mouse IgG antibody, which can be prepared more easily than an antibody and has a binding ability equal to or higher than that of an antibody. The nucleic acid molecule according to the present invention may have the sequences set forth in SEQ ID NOS: 1 to 5. The nucleic acid molecule according to the present invention may be a nucleic acid having an ability to bind to a rabbit IgG antibody, which substantially has homology to its sequence. The nucleic acid molecule according to the present invention may have a binding constant (KD) of 1.18×10?7 (M) or less to the rabbit IgG antibody.

Abstract: The present invention is to provide a method for obtaining an oligonucleotide such as RNA aptamer having high binding capacity to a target substance with easy-to-use and high purity. The method for obtaining oligonucleotide according to the present invention is as follows: A method for obtaining oligonucleotide comprising the steps of: performing an electrophoresis of a nucleic acid molecule/target substance complex comprising a nucleic acid molecule and a target substance; recovering said nucleic acid molecule/target substance complex; extracting the nucleic acid molecule from said nucleic acid molecule/target substance complex; gene amplifying said nucleic acid molecule.

Abstract: The present invention provides a process for generation of a transformed plant capable of emitting fluorescence by introducing a gene encoding a non-plant-derived fluorescent protein into a plant such that the fluorescent protein is recombinantly expressed in the active form of its mature protein in the leaf or petal of the plant, and also provides a transformed garden plant capable of emitting fluorescence that is generated by using the process. For example, cDNA encoding the full-length amino acid sequence of a Chiridius poppei-derived fluorescent protein CpYGFP or its H52F modified protein CpYGFP H52F is inserted into a T-DNA-based expression vector system, which is in turn introduced into the chromosomal DNA of a plant. As a result, the transformed plant thus generated can exhibit fluorescence attributed to these fluorescent proteins and exhibit no substantial difference in the other phenotypes from wild-type one of the plant.

Abstract: The present invention provides a “nucleic acid adaptor molecule” having specific binding affinity to a GST protein portion serving as an N-terminal fusion partner in a fusion protein consisting of the GST protein and a protein of interest. A “nucleic acid adaptor molecule against a GST protein” according to the present invention is an RNA aptamer molecule having any of the following nucleotide sequences I to III: nucleotide sequence I (SEQ ID NO: 1): GGUAGAUACGAUGGAUGGUUGUGUAAAGGUGGUCGUAUCCGCCGA CAUG ACGCGCAGCCAA 61; nucleotide sequence II (SEQ ID NO: 2): GGUAGAUACGAUGGACUAACUGCGCAAAUUACUCGUAUUAGCCGA CAUG ACGCGCAGCCAA 61; or nucleotide sequence III (SEQ ID NO: 3): GGUAGAUACGAUGGAUACCGAAAAAUUAGUGUCGUUGACUGCAA CAUGA CGCGCAGCCAA 60.

Abstract: The present invention relates to a computer system comprising a database for elucidating changes in gene expression in prostate tissue isolated from patients exhibiting different clinical states of prostate hyperplasia as compared to normal prostate tissue, as well as the identification of individual genes that are differentially expressed in diseased prostate tissue.

Abstract: The present invention is based on the elucidation of the global changes in gene expression in prostate tissue isolated from patients exhibiting different clinical states of prostate hyperplasia as compared to normal prostate tissue as well as the identification of individual genes that are differentially expressed in diseased prostate tissue.

Abstract: The present invention is based on the elucidation of the global changes in gene expression in prostate tissue isolated from patients exhibiting different clinical states of prostate hyperplasia as compared to normal prostate tissue as well as the identification of individual genes that are differentially expressed in diseased prostate tissue.