Patents by Inventor J. Michael Ruppert

J. Michael Ruppert has filed for patents to protect the following inventions. This listing includes patent applications that are pending as well as patents that have already been granted by the United States Patent and Trademark Office (USPTO).

  • MicroRNAs 206 and 21 cooperate to promote RAS-extracellular signal-regulated kinase signaling by suppressing the translation of RASA1 and SPRED1
    Patent number: 10221415
    Abstract: The present invention provides a method for inhibiting the RAS-ERK pathway by upregulation of RASA1 and SPRED1 mRNAs in tumor cells by anti-miR treatment. The method includes wherein an anti-miR-206 binds to a nucleotide comprising the sequence UAGCUUAUCAGACU (SEQ ID NO: 21), or to a nucleotide comprising the sequence UGGAAUGUAAGGAAGUGUGUGG (SEQ ID NO: 9). A method of re-expression of RAS-ERK pathway inhibitory proteins in triple negative cancer cells by administering to a patient having cancer an effective amount of an antagonist of KLF4-dependent microRNAs.
    Type: Grant
    Filed: August 31, 2016
    Date of Patent: March 5, 2019
    Assignee: West Virginia University
    Inventors: Sriganesh B. Sharma, Chen-Chung Lin, Mark K. Farrugia, J. Michael Ruppert
  • MicroRNAs 206 and 21 Cooperate To Promote RAS-Extracellular Signal-Regulated Kinase Signaling by Suppressing the Translation of RASA1 and SPRED1
    Publication number: 20170067049
    Abstract: The present invention provides a method for inhibiting the RAS-ERK pathway by upregulation of RASA1 and SPRED1 mRNAs in tumor cells by anti-miR treatment. The method includes wherein an anti-miR-206 binds to a nucleotide comprising the sequence UAGCUUAUCAGACU (SEQ ID NO: 21), or to a nucleotide comprising the sequence UGGAAUGUAAGGAAGUGUGUGG (SEQ ID NO: 9). A method of re-expression of RAS-ERK pathway inhibitory proteins in triple negative cancer cells by administering to a patient having cancer an effective amount of an antagonist of KLF4-dependent microRNAs.
    Type: Application
    Filed: August 31, 2016
    Publication date: March 9, 2017
    Inventors: Sriganesh B. Sharma, Chen-Chung Lin, Mark K. Farrugia, J. Michael Ruppert
  • Krüppel-like transcriptional factor KLF4/GKLF and uses thereof
    Patent number: 7364868
    Abstract: The present invention proivdes methods of identifying new carcinoma oncogenes or analyzing functions of known carcinoma oncogenes by transformation of RK3E cells. Also provided are methods of using nuclear localization of Krüppel-like factor 4 (KLF4, or termed Gut-Enriched Krüppel-Like Factor, GKLF) as a marker and prognostic factor for aggressive early-stage breast carcinoma.
    Type: Grant
    Filed: February 11, 2004
    Date of Patent: April 29, 2008
    Assignee: The UAB Research Foundation
    Inventors: J. Michael Ruppert, Jeffrey Allen Engler
  • Kruppel-like transcriptional factor KLF4/GKLF and uses thereof
    Publication number: 20040235073
    Abstract: The present invention proivdes methods of identifying new carcinoma oncogenes or analyzing functions of known carcinoma oncogenes by transformation of RK3E cells. Also provided are methods of using nuclear localization of Krüppel-like factor 4 (KLF4, or termed Gut-Enriched Krüppel-Like Factor, GKLF) as a marker and prognostic factor for aggressive early-stage breast carcinoma.
    Type: Application
    Filed: February 11, 2004
    Publication date: November 25, 2004
    Inventors: J. Michael Ruppert, Jeffrey Allen Engler
  • Oncogene identification by transformation of RK3E cells and uses thereof
    Publication number: 20030138799
    Abstract: The present invention is directed to methods of identifying new carcinoma oncogenes or analyzing functions of known carcinoma oncogenes by transformation of RK3E cells. Also provided are methods of identifying oncogene-specificity of known drugs or screening for new drugs that inhibit oncogenes activated in carcinoma by utilizing RK3E cells. Further provided are methods of identifying alterations in cellular enzyme, protein, or mRNA levels or activities by utilizing RK3E and oncogene-transformed derivatives. Still further provided are a novel oncogene GKLF with cDNA sequence and amino acid sequence for the protein, and applications of such gene/protein in medical diagnosis and treatment.
    Type: Application
    Filed: July 12, 2002
    Publication date: July 24, 2003
    Inventors: J. Michael Ruppert, Jeffrey Allen Engler