Patents by Inventor Jörg Vollmer

Jörg Vollmer has filed for patents to protect the following inventions. This listing includes patent applications that are pending as well as patents that have already been granted by the United States Patent and Trademark Office (USPTO).

  • Publication number: 20220273741
    Abstract: The invention relates to a virus particle comprising a lymphocytic choriomeningitis virus (LCMV) S segment and an LCMV L segment, wherein the S segment comprises an open reading frame encoding a glycoprotein derived from LCMV strain WE, and wherein the L segment comprises an open reading frame encoding an L protein derived from LCMV strain Clone13. The invention also relates to related host cells, methods of producing such virus particles, pharmaceutical compositions comprising such virus particles, and medical uses of such virus particles.
    Type: Application
    Filed: February 25, 2022
    Publication date: September 1, 2022
    Applicant: Abalos Therapeutics GmbH
    Inventors: Jorg VOLLMER, Marcus KOSTKA, Philipp LANG, Haifeng XU
  • Publication number: 20180171338
    Abstract: The present invention relates generally to immunostimulatory nucleic acids, compositions thereof and methods of using the immunostimulatory nucleic acids. In particular the invention relates to palindrome-containing immunostimulatory nucleic acids and the use of these nucleic acids in treating disease.
    Type: Application
    Filed: February 5, 2018
    Publication date: June 21, 2018
    Applicant: Adiu Tide Pharmaceuticals GmbH
    Inventors: Eugen Uhlmann, Jörg Vollmer, Arthur M. Krieg, Ulrike Samulowitz, Bernard O. Noll
  • Patent number: 8834900
    Abstract: A class of immunostimulatory nucleic acids having at least two functionally and structurally defined domains is provided. This class of combination motif immunostimulatory nucleic acids activates an immune response and is useful for treating a variety of immune related disorders such as cancer, infectious disease, and allergic disorders. The nucleic acids also stimulate activation of natural killer cells and production of type 1 interferon.
    Type: Grant
    Filed: August 19, 2002
    Date of Patent: September 16, 2014
    Assignees: University of Iowa Research Foundation, Coley Pharmaceutical GmbH
    Inventors: Arthur M. Krieg, Jorg Vollmer
  • Patent number: 8466124
    Abstract: Immunostimulatory polymers that contain certain sequence-dependent immunostimulatory RNA motifs and methods for the use of such immunostimulatory polymers and compositions containing such polymers are provided according to the invention. The sequence-dependent immunostimulatory RNA motifs and the polymers incorporating such motifs are potent and selective inducers of TLR7 and the TLR7-associated cytokine IFN-?.
    Type: Grant
    Filed: June 12, 2012
    Date of Patent: June 18, 2013
    Assignee: Coley Pharmaceutical GmbH
    Inventors: Marion Jurk, Jorg Vollmer
  • Patent number: 8354522
    Abstract: The invention provides immunostimulatory compositions and use of those compounds in the preparation of medicaments for the treatment of disease as well as in vitro uses. In particular, the compositions of the invention include immunostimulatory oligoribonucleotides that incorporate a sequence-dependent immunostimulatory sequence motif. Specific modifications involving phosphate linkages, nucleotide analogs, adducts, and combinations thereof are provided. Compositions of the invention, which optionally can include an antigen, can be used alone or together with other treatments to stimulate or enhance an immune response. Also provided are compositions and methods useful for treating a subject having an infection, a cancer, an allergic condition, asthma, airway remodeling, or immunodeficiency. Immunostimulatory oligoribonucleotides of the invention are believed to stimulate Toll-like receptor 8 (TLR8).
    Type: Grant
    Filed: March 14, 2011
    Date of Patent: January 15, 2013
    Assignees: Coley Pharmaceutical GmbH, Coley Pharmaceutical Group, Inc.
    Inventors: Alexandra Forsbach, Jorg Vollmer, Grayson B. Lipford
  • Patent number: 8304396
    Abstract: The invention relates to a class of soft or semi-soft CpG immunostimulatory oligonucleotides that are useful for stimulating an immune response.
    Type: Grant
    Filed: October 4, 2006
    Date of Patent: November 6, 2012
    Assignees: Coley Pharmaceutical Group, Inc., Coley Pharmaceutical GmbH, Pfizer Inc.
    Inventors: Arthur M. Krieg, Ulrike Samulowitz, Jörg Vollmer, Eugen Uhlmann, Marion Jurk, Grayson B. Lipford, Robert Rankin
  • Publication number: 20120258140
    Abstract: Immunostimulatory polymers that contain certain sequence-dependent immunostimulatory RNA motifs and methods for the use of such immunostimulatory polymers and compositions containing such polymers are provided according to the invention. The sequence-dependent immunostimulatory RNA motifs and the polymers incorporating such motifs are potent and selective inducers of TLR7 and the TLR7-associated cytokine IFN-?.
    Type: Application
    Filed: June 12, 2012
    Publication date: October 11, 2012
    Applicant: COLEY PHARMACEUTICAL GMBH
    Inventors: Marion Jurk, Jorg Vollmer
  • Patent number: 8283328
    Abstract: The invention relates to a class of soft or semi-soft CpG immunostimulatory oligonucleotides that are useful for stimulating an immune response.
    Type: Grant
    Filed: August 19, 2003
    Date of Patent: October 9, 2012
    Assignees: Coley Pharmaceutical Group, Inc., Coley Pharmaceutical GmbH
    Inventors: Arthur M. Krieg, Grayson Lipford, Ulrike Samulowitz, Jörg Vollmer, Eugen Uhlmann, Marion Jurk, Robert Rankin
  • Publication number: 20120219571
    Abstract: Immunostimulatory oligonucleotides, which contain a CpG immunostimulatory motif and a second motif that is capable of forming secondary structure, including duplex and higher order structures in vitro and in vivo, are disclosed. They include nucleic acids, or pharmaceutically acceptable salts thereof, having base sequences that include 5? TCGTCGTTTTCGGCGCGCGCCGT 3? (SEQ ID NO: 1), in which each C is unmethylated and 3? refers to the 3? end of the nucleic acid. The oligonucleotides activate B cells and NK cells and induce expression of type I interferon and interferon-?. The oligonucleotides are useful for treating a variety of disorders and conditions, including allergy, asthma, infection, and cancer. In addition to their use as single agents and as combination therapies, the disclosed oligonucleotides are useful as adjuvants in vaccines.
    Type: Application
    Filed: May 14, 2012
    Publication date: August 30, 2012
    Applicants: COLEY PHARMACEUTICAL GMBH, PFIZER INC, COLEY PHARMACEUTICAL GROUP, INC.
    Inventors: JORG VOLLMER, EUGEN UHLMANN, ARTHUR M. KRIEG, DOUGLAS C. HANSON, ULRIKE SAMULOWITZ
  • Patent number: 8227447
    Abstract: Immunostimulatory polymers that contain certain sequence-dependent immunostimulatory RNA motifs and methods for the use of such immunostimulatory polymers and compositions containing such polymers are provided according to the invention. The sequence-dependent immunostimulatory RNA motifs and the polymers incorporating such motifs are potent and selective inducers of TLR7 and the TLR7-associated cytokine IFN-?.
    Type: Grant
    Filed: January 30, 2012
    Date of Patent: July 24, 2012
    Assignee: Coley Pharmaceutical GmbH
    Inventors: Marion Jurk, Jorg Vollmer
  • Patent number: 8198251
    Abstract: Immunostimulatory oligonucleotides, which contain a CpG immunostimulatory motif and a second motif that is capable of forming secondary structure, including duplex and higher order structures in vitro and in vivo, are disclosed. They include nucleic acids, or pharmaceutically acceptable salts thereof, having base sequences that include 5? TCGTCGTTTTCGGCGCGCGCCGT 3? (SEQ ID NO: 1), in which each C is unmethylated and 3? refers to the 3? end of the nucleic acid. The oligonucleotides activate B cells and NK cells and induce expression of type I interferon and interferon-?. The oligonucleotides are useful for treating a variety of disorders and conditions, including allergy, asthma, infection, and cancer. In addition to their use as single agents and as combination therapies, the disclosed oligonucleotides are useful as adjuvants in vaccines.
    Type: Grant
    Filed: August 12, 2008
    Date of Patent: June 12, 2012
    Assignees: Coley Pharmaceutical GmbH, Coley Pharmaceutical Group, Inc., Pfizer Inc
    Inventors: Jorg Vollmer, Eugen Uhlmann, Arthur M. Krieg, Douglas C. Hanson, Ulrike Samulowitz
  • Patent number: 8188254
    Abstract: The invention relates to a class of CpG immunostimulatory oligonucleotides containing a CpG immunostimulatory motif and a second motif which is capable of forming secondary structure, including duplex and higher order structures, in vitro and in vivo. The oligonucleotides of the invention are useful as adjuvants in vaccination. The oligonucleotides are also useful for inducing an immune response, inducing expression of a type I interferon (IFN), inducing expression of gamma interferon (IFN-?), and for treating a variety of conditions, including allergy, asthma, infection, and cancer.
    Type: Grant
    Filed: October 29, 2004
    Date of Patent: May 29, 2012
    Assignees: Coley Pharmaceutical GmbH, Coley Pharmaceutical Group, Inc.
    Inventors: Eugen Uhlmann, Jörg Vollmer, Arthur M. Krieg, Bernhard O. Noll
  • Publication number: 20120121648
    Abstract: Immunostimulatory polymers that contain certain sequence-dependent immunostimulatory RNA motifs and methods for the use of such immunostimulatory polymers and compositions containing such polymers are provided according to the invention. The sequence-dependent immunostimulatory RNA motifs and the polymers incorporating such motifs are potent and selective inducers of TLR7 and the TLR7-associated cytokine IFN-?.
    Type: Application
    Filed: January 30, 2012
    Publication date: May 17, 2012
    Applicant: COLEY PHARMACEUTICAL GMBH
    Inventors: Marion Jurk, Jorg Vollmer
  • Patent number: 8128944
    Abstract: Immunostimulatory polymers that contain certain sequence-dependent immunostimulatory RNA motifs and methods for the use of such immunostimulatory polymers and compositions containing such polymers are provided according to the invention. The sequence-dependent immunostimulatory RNA motifs and the polymers incorporating such motifs are potent and selective inducers of TLR7 and the TLR7-associated cytokine IFN-?.
    Type: Grant
    Filed: August 8, 2008
    Date of Patent: March 6, 2012
    Assignee: Coley Pharmaceutical GmbH
    Inventors: Marion Jurk, Jorg Vollmer
  • Publication number: 20110206719
    Abstract: The invention provides immunostimulatory compositions and use of those compounds in the preparation of medicaments for the treatment of disease as well as in vitro uses. In particular, the compositions of the invention include immunostimulatory oligoribonucleotides that incorporate a sequence-dependent immunostimulatory sequence motif. Specific modifications involving phosphate linkages, nucleotide analogs, adducts, and combinations thereof are provided. Compositions of the invention, which optionally can include an antigen, can be used alone or together with other treatments to stimulate or enhance an immune response. Also provided are compositions and methods useful for treating a subject having an infection, a cancer, an allergic condition, asthma, airway remodeling, or immunodeficiency. Immunostimulatory oligoribonucleotides of the invention are believed to stimulate Toll-like receptor 8 (TLR8).
    Type: Application
    Filed: March 14, 2011
    Publication date: August 25, 2011
    Applicants: COLEY PHARMACEUTICAL GMBH, COLEY PHARMACEUTICAL GROUP, INC.
    Inventors: Alexandra Forsbach, Jörg Vollmer, Grayson B. Lipford
  • Publication number: 20110201672
    Abstract: The invention relates to specific C-Class semi-soft CpG immunostimulatory oligonucleotides that are useful for stimulating an immune response. In particular the oligonucleotides are useful for treating allergy, such as allergic rhinitis and asthma, cancer and infectious disease, such as hepatitis B and hepatitis C.
    Type: Application
    Filed: September 14, 2010
    Publication date: August 18, 2011
    Inventors: Arthur M. Krieg, Ulrike Samulowitz, Jörg Vollmer, Eugen Uhlmann
  • Patent number: 7998492
    Abstract: The invention provides methods for identifying and treating subjects having hepatitis C infections. In some instances, the subjects are those that are non-responsive to non-CpG therapy. Preferably, the subjects are treated with C class CpG immunostimulatory nucleic acids having a semi-soft backbone.
    Type: Grant
    Filed: October 29, 2003
    Date of Patent: August 16, 2011
    Assignees: Coley Pharmaceutical Group, Inc., Coley Pharmaceutical GmbH
    Inventors: Navneet K. Ahluwalia, Susan M. Efler, Heather L. Davis, Jörg Vollmer
  • Publication number: 20110135605
    Abstract: The invention provides methods for identifying and treating subjects having hepatitis C infections. In some instances, the subjects are those that are non-responsive to non-CpG therapy. Preferably, the subjects are treated with C class CpG immunostimulatory nucleic acids having semi-soft backbone.
    Type: Application
    Filed: November 15, 2010
    Publication date: June 9, 2011
    Applicants: Coley Pharmaceutical Group, Inc., Coley Pharmaceutical GmbH
    Inventors: Navneet K. Ahluwalia, Susan M. Efler, Heather L. Davis, Jörg Vollmer
  • Patent number: 7956043
    Abstract: The invention relates to a class of CpG immunostimulatory oligonucleotides containing a 5?TCG motif or a CG at or near the 5? end that are useful for stimulating an immune response.
    Type: Grant
    Filed: December 11, 2003
    Date of Patent: June 7, 2011
    Assignees: Coley Pharmaceutical Group, Inc., Coley Pharmaceutical GmbH
    Inventors: Arthur M. Krieg, Marion Jurk, Jorg Vollmer, Eugen Uhlmann
  • Publication number: 20100316659
    Abstract: The invention provides immunostimulatory compositions and use of those compounds in the preparation of medicaments for the treatment of disease as well as in vitro uses. In particular, the compositions of the invention include immunostimulatory oligoribonucleotides that incorporate a sequence-dependent immunostimulatory sequence motif. Specific modifications involving phosphate linkages, nucleotide analogs, adducts, and combinations thereof are provided. Compositions of the invention, which optionally can include an antigen, can be used alone or together with other treatments to stimulate or enhance an immune response. Also provided are compositions and methods useful for treating a subject having an infection, a cancer, an allergic condition, asthma, airway remodeling, or immunodeficiency. Immunostimulatory oligoribonucleotides of the invention are believed to stimulate Toll-like receptor 8 (TLR8).
    Type: Application
    Filed: December 9, 2009
    Publication date: December 16, 2010
    Applicants: COLEY PHARMACEUTICAL GMBH, COLEY PHARMACEUTICAL GROUP, INC.
    Inventors: Alexandra Forsbach, Jörg Vollmer, Grayson B. Lipford