Abstract: An example method includes determining a point cloud representation of surfaces within an environment. The method further includes providing for display of a graphical interface that shows a model of the surfaces within the environment based on the point cloud representation. The method additionally includes receiving input data indicating one or more positions for one or more virtual sensors on the graphical interface corresponding to one or more physical positions within the environment. The method also includes determining one or more occluded regions within the environment, where the one or more occluded regions are predicted to be occluded from view by one or more sensors positioned at the one or more physical positions within the environment. The method also includes providing for display in the graphical interface of a graphical representation of the one or more occluded regions within the model of the surfaces within the environment.

Abstract: A title management apparatus resident on a first computer including a memory for storing a control program and data, and a processor for executing the control program and for managing the data. The apparatus includes a title object resident in the memory including a title structure, the title structure further comprising a content element, a set of attributes, and a set of title object security indicia. The apparatus further includes an authorization structure configured to selectively redeem the content element based at least in part on the user security indicia, and further configured to use a set of protocols. The apparatus also includes a title management structure configured to associate a user with the title object based at least in part on the user data and the title attributes.

Abstract: A method of facilitating a transaction between a merchant and a buyer using a computerized system including a set of titles. The method includes storing the set of titles in a merchant site corresponding to a set of products for sale; browsing the merchant site using a client device and selecting a product for purchase; and generating a payment slip title for the product including information relating to a payment amount and a buyer identifier. The method further includes selecting a payment structure from a set of available payment structures; modifying the payment slip title to include information corresponding to the selected payment structure; releasing the product title to the buyer; and transmitting the payment amount to the merchant.

Abstract: A method of facilitating a transaction between a merchant and a buyer using a computerized system including a set of titles. The method includes storing the set of titles in a merchant site corresponding to a set of products for sale; browsing the merchant site using a client device and selecting a product for purchase; and generating a payment slip title for the product including information relating to a payment amount and a buyer identifier. The method further includes selecting a payment structure from a set of available payment structures; modifying the payment slip title to include information corresponding to the selected payment structure; releasing the product title to the buyer; and transmitting the payment amount to the merchant.

Abstract: A title management apparatus resident on a first computer including a memory for storing a control program and data, and a processor for executing the control program and for managing the data. The apparatus includes user data resident in the memory including a set of user security indicia. The apparatus also includes a first title object resident in the memory including a title structure, the title structure further comprising a content element, a set of attributes, and a set of title object security indicia. The apparatus further includes a set of stub objects coupled to the title object, wherein the set of stub objects can further optimize the title structure; an authorization structure configured to selectively redeem the content element based at least in part of the user security indicia; and, a title management structure configured to associate a user with the first title object based at least in part of the user data and the title attributes.

Abstract: A title management apparatus resident on a first computer including a memory for storing a control program and data, and a processor for executing the control program and for managing the data. The apparatus includes user data resident in the memory including a set of user security indicia. The apparatus also includes a first title object resident in the memory including a title structure, the title structure further comprising a content element, a set of attributes, and a set of title object security indicia. The apparatus further includes a set of stub objects coupled to the title object, wherein the set of stub objects can further optimize the title structure; an authorization structure configured to selectively redeem the content element based at least in part of the user security indicia; and, a title management structure configured to associate a user with the first title object based at least in part of the user data and the title attributes.

Abstract: A title management apparatus resident on a first computer including a memory for storing a control program and data, and a processor for executing the control program and for managing the data. The apparatus includes a title object resident in the memory including a title structure, the title structure further comprising a content element, a set of attributes, and a set of title object security indicia. The apparatus further includes an authorization structure configured to selectively redeem the content element based at least in part on the user security indicia, and further configured to use a set of protocols. The apparatus also includes a title management structure configured to associate a user with the title object based at least in part on the user data and the title attributes.

Abstract: A title management apparatus resident on a first computer including a memory for storing a control program and data, and a processor for executing the control program and for managing the data. The apparatus includes a title object resident in the memory including a title structure, the title structure further comprising a content element, a set of attributes, and a set of title object security indicia. The apparatus further includes an authorization structure configured to selectively redeem the content element based at least in part on the user security indicia, and further configured to use a set of protocols. The apparatus also includes a title management structure configured to associate a user with the title object based at least in part on the user data and the title attributes.

Abstract: A method of facilitating a transaction between a merchant and a buyer using a computerized system including a set of titles. The method includes storing the set of titles in a merchant site corresponding to a set of products for sale; browsing the merchant site using a client device and selecting a product for purchase; and generating a payment slip title for the product including information relating to a payment amount and a buyer identifier. The method further includes selecting a payment structure from a set of available payment structures; modifying the payment slip title to include information corresponding to the selected payment structure; releasing the product title to the buyer; and transmitting the payment amount to the merchant.

Abstract: A title management apparatus resident on a first computer including a memory for storing a control program and data, and a processor for executing the control program and for managing the data. The apparatus includes user data resident in the memory including a set of user security indicia. The apparatus also includes a first title object resident in the memory including a title structure, the title structure further comprising a content element, a set of attributes, and a set of title object security indicia. The apparatus further includes a set of stub objects coupled to the title object, wherein the set of stub objects can further optimize the title structure; an authorization structure configured to selectively redeem the content element based at least in part of the user security indicia; and, a title management structure configured to associate a user with the first title object based at least in part of the user data and the title attributes.

Abstract: A method of facilitating a transaction between a merchant and a buyer using a computerized system including a set of titles. The method includes storing the set of titles in a merchant site corresponding to a set of products for sale; browsing the merchant site using a client device and selecting a product for purchase; and generating a payment slip title for the product including information relating to a payment amount and a buyer identifier. The method further includes selecting a payment structure from a set of available payment structures; modifying the payment slip title to include information corresponding to the selected payment structure; releasing the product title to the buyer; and transmitting the payment amount to the merchant.

Abstract: A title management apparatus resident on a first computer including a memory for storing a control program and data, and a processor for executing the control program and for managing the data. The apparatus includes user data resident in the memory including a set of user security indicia. The apparatus also includes a first title object resident in the memory including a title structure, the title structure further comprising a content element, a set of attributes, and a set of title object security indicia. The apparatus further includes a set of stub objects coupled to the title object, wherein the set of stub objects can further optimize the title structure; an authorization structure configured to selectively redeem the content element based at least in part of the user security indicia; and, a title management structure configured to associate a user with the first title object based at least in part of the user data and the title attributes.

Abstract: An automated system for analyzing mask defects in a semiconductor manufacturing process is presented. This system combines results from an inspection tool and design layout data from a design data repository corresponding to each mask layer being inspected with a computer program and a predetermined rule set to determine when a defect on a given mask layer has occurred. Mask inspection results include the presence, location and type (clear or opaque) of defects. Ultimately, a determination is made as to whether to scrap, repair or accept a given mask based on whether the defect would be likely to cause product failure. Application of the defect inspection data to the design layout data for each mask layer being inspected prevents otherwise acceptable wafer masks from being scrapped when the identified defects are not in critical areas of the mask.

Abstract: An automated system for analyzing mask defects in a semiconductor manufacturing process is presented. This system combines results from an inspection tool and design layout data from a design data repository corresponding to each mask layer being inspected with a computer program and a predetermined rule set to determine when a defect on a given mask layer has occurred. Mask inspection results include the presence, location and type (clear or opaque) of defects. Ultimately, a determination is made as to whether to scrap, repair or accept a given mask based on whether the defect would be likely to cause product failure. Application of the defect inspection data to the design layout data for each mask layer being inspected prevents otherwise acceptable wafer masks from being scrapped when the identified defects are not in critical areas of the mask.

Abstract: The present invention provides synthetic ?-secretase peptide substrates useful in various assays for measuring ?-secretase activity. Antibodies that recognize the synthetic substrates and uses of the antibodies in various assays are disclosed. The herein disclosed peptide substrates are hydrolyzed at rates substantially faster than the attendant Swedish mutant APP from which the substrate sequences are derived.

Abstract: A method of optimizing a contact management system using a computerized system including a set of titles. The method includes storing a set of user identity records in an identity management site, wherein each record of the set of user identity records can be redeemed by a pointer. The method also includes generating a contact title including the pointer for the record; storing the contact title in a first title management site; selecting the contact title; redeeming the record from the identity management site; and displaying the record.

Abstract: There are disclosed aptamer ligands to MUC1, preferably comprising a sequence selected from: ?1 CGAATGGGCCCGTCCTCGCTGTAAG ?2 GCAACAGGGTATCCAAAGGATCAAA ?3 GTTCGACAGGAGGCTCACAACAGGC ?4 TGTTGGTCAGGCGGCGGCTCTACAT ?5 CTCTGTTCTTATTTGCGAGTTXXXX ?6 XCTCTGTTCTTATTTGCGAGTTXXX ?7 XXCTCTGTTCTTATTTGCGAGTTXX ?8 XXXCTCTGTTCTTATTTGCGAGTTX ?9 XXXXCTCTGTTCTTATTTGCGAGTT 10 CTCTGTTCTTATTTGCGAGTT 11 CCCTCTGTTCTTATTTGCGAGTTCA 12 CTCTGTTCTTATTTGCGAGTTGGTG 13 CCCTCTGTTCTTATTTGCGAGTTCA 14 TAAGAACAGGGCGTCGTGTTACGAG 15 GTGGCTTACTGCGAGGACGGGCCCA 16 GCAGTTGATCCTTTGGATACCCTGG 17 AACCCTATCCACTTTTCGGCTCGGG 18 CGATTTAGTCTCTGTCTCTAGGGGT 19 CGACAGGAGGCTCACAACAGGCAAC 20 AGAACGAAGCGTTCGACAGGAGGCT 21 AGAAACACTTGGTATATCGCAGATA 22 GGGAGACAAGAATAAACACTCAACG and compounds comprising these aptamers and sequences.

Abstract: A design verification method, including (a) providing in a design a design electrically conducting line and a design contact region being in direct physical contact with the design electrically conducting line; (b) modeling a simulated electrically conducting line of the design electrically conducting line; (c) simulating a possible contact region of the design contact region, wherein the design contact region and the possible contact region are not identical; and (d) determining that the design electrically conducting line and the design contact region are potentially defective if an interfacing surface area of the simulated electrically conducting line and the possible contact region is less than a pre-specified value.

Abstract: Methods and apparatus are describe for providing access to identity information corresponding to a first entity. The identity information includes a plurality of identity components stored in a distributed manner. A first identity access title object is generated which is operable to confer rights to access first selected ones of the identity components to a presenter of the first identity access title object. The first identity access title object is transmitted to a second entity. Access to the first selected identity components is facilitated in response to presentation of the first identity access title object by the second entity.

Abstract: Particular aspects provide novel protein interaction reporter (PIR) compounds (e.g., formulas I and II), comprising at least two protein reactive moieties (e.g., N-hydroxysuccinamide), each linked to a reporter moiety (e.g., mass reporter) by a covalent labile bond that is differentially cleavable with respect to peptide bonds (e.g., by a method such as collisional activation in a mass spectrometer, activation by electron capture dissociation (ECD), photoactivation, etc.), wherein the reporter moiety is operatively releasable from the PIR agent upon cleavage of the labile bonds, the released reporter moiety having a characteristic identifying property or label (e.g., m/z value). Particular PIRs comprise a mass reporter moiety, and further comprise an affinity group, (e.g., biotin), linked to the PIR (e.g., to the mass reporter moiety) by a selectively cleavable bone (e.g. photo-labile bond)).