Patents by Inventor James Bruce

James Bruce has filed for patents to protect the following inventions. This listing includes patent applications that are pending as well as patents that have already been granted by the United States Patent and Trademark Office (USPTO).

  • Patent number: 10565786
    Abstract: An example method includes determining a point cloud representation of surfaces within an environment. The method further includes providing for display of a graphical interface that shows a model of the surfaces within the environment based on the point cloud representation. The method additionally includes receiving input data indicating one or more positions for one or more virtual sensors on the graphical interface corresponding to one or more physical positions within the environment. The method also includes determining one or more occluded regions within the environment, where the one or more occluded regions are predicted to be occluded from view by one or more sensors positioned at the one or more physical positions within the environment. The method also includes providing for display in the graphical interface of a graphical representation of the one or more occluded regions within the model of the surfaces within the environment.
    Type: Grant
    Filed: June 30, 2016
    Date of Patent: February 18, 2020
    Assignee: Google LLC
    Inventors: Greg Klein, James Bruce, Arshan Poursohi
  • Publication number: 20150026080
    Abstract: A title management apparatus resident on a first computer including a memory for storing a control program and data, and a processor for executing the control program and for managing the data. The apparatus includes a title object resident in the memory including a title structure, the title structure further comprising a content element, a set of attributes, and a set of title object security indicia. The apparatus further includes an authorization structure configured to selectively redeem the content element based at least in part on the user security indicia, and further configured to use a set of protocols. The apparatus also includes a title management structure configured to associate a user with the title object based at least in part on the user data and the title attributes.
    Type: Application
    Filed: July 23, 2014
    Publication date: January 22, 2015
    Inventors: Stefan Roever, Kevin Collins, Josh C. Ding, Alex F. Clark, James Bruce
  • Publication number: 20140236746
    Abstract: A method of facilitating a transaction between a merchant and a buyer using a computerized system including a set of titles. The method includes storing the set of titles in a merchant site corresponding to a set of products for sale; browsing the merchant site using a client device and selecting a product for purchase; and generating a payment slip title for the product including information relating to a payment amount and a buyer identifier. The method further includes selecting a payment structure from a set of available payment structures; modifying the payment slip title to include information corresponding to the selected payment structure; releasing the product title to the buyer; and transmitting the payment amount to the merchant.
    Type: Application
    Filed: April 4, 2014
    Publication date: August 21, 2014
    Applicant: OnCircle, Inc.
    Inventors: Stefan Roever, Kevin Collins, Josh C. Ding, Alex F. Clark, James Bruce
  • Patent number: 8738457
    Abstract: A method of facilitating a transaction between a merchant and a buyer using a computerized system including a set of titles. The method includes storing the set of titles in a merchant site corresponding to a set of products for sale; browsing the merchant site using a client device and selecting a product for purchase; and generating a payment slip title for the product including information relating to a payment amount and a buyer identifier. The method further includes selecting a payment structure from a set of available payment structures; modifying the payment slip title to include information corresponding to the selected payment structure; releasing the product title to the buyer; and transmitting the payment amount to the merchant.
    Type: Grant
    Filed: March 2, 2010
    Date of Patent: May 27, 2014
    Assignee: OnCircle, Inc.
    Inventors: Stefan Roever, Kevin Collins, Josh C. Ding, Alex F. Clark, James Bruce
  • Publication number: 20140019372
    Abstract: A title management apparatus resident on a first computer including a memory for storing a control program and data, and a processor for executing the control program and for managing the data. The apparatus includes user data resident in the memory including a set of user security indicia. The apparatus also includes a first title object resident in the memory including a title structure, the title structure further comprising a content element, a set of attributes, and a set of title object security indicia. The apparatus further includes a set of stub objects coupled to the title object, wherein the set of stub objects can further optimize the title structure; an authorization structure configured to selectively redeem the content element based at least in part of the user security indicia; and, a title management structure configured to associate a user with the first title object based at least in part of the user data and the title attributes.
    Type: Application
    Filed: September 19, 2013
    Publication date: January 16, 2014
    Applicant: OnCircle, Inc.
    Inventors: Stefan Roever, Kevin Collins, Josh C. Ding, Alex F. Clark, James Bruce
  • Patent number: 8571992
    Abstract: A title management apparatus resident on a first computer including a memory for storing a control program and data, and a processor for executing the control program and for managing the data. The apparatus includes user data resident in the memory including a set of user security indicia. The apparatus also includes a first title object resident in the memory including a title structure, the title structure further comprising a content element, a set of attributes, and a set of title object security indicia. The apparatus further includes a set of stub objects coupled to the title object, wherein the set of stub objects can further optimize the title structure; an authorization structure configured to selectively redeem the content element based at least in part of the user security indicia; and, a title management structure configured to associate a user with the first title object based at least in part of the user data and the title attributes.
    Type: Grant
    Filed: March 3, 2010
    Date of Patent: October 29, 2013
    Assignee: OnCircle, Inc.
    Inventors: Stefan Roever, Kevin Collins, Josh C. Ding, Alex F. Clark, James Bruce
  • Publication number: 20100299718
    Abstract: A title management apparatus resident on a first computer including a memory for storing a control program and data, and a processor for executing the control program and for managing the data. The apparatus includes a title object resident in the memory including a title structure, the title structure further comprising a content element, a set of attributes, and a set of title object security indicia. The apparatus further includes an authorization structure configured to selectively redeem the content element based at least in part on the user security indicia, and further configured to use a set of protocols. The apparatus also includes a title management structure configured to associate a user with the title object based at least in part on the user data and the title attributes.
    Type: Application
    Filed: August 4, 2010
    Publication date: November 25, 2010
    Applicant: NAVIO SYSTEMS, INC.
    Inventors: Stefan Roever, Kevin Collins, Josh C. Ding, Alex F. Clark, James Bruce
  • Patent number: 7814025
    Abstract: A title management apparatus resident on a first computer including a memory for storing a control program and data, and a processor for executing the control program and for managing the data. The apparatus includes a title object resident in the memory including a title structure, the title structure further comprising a content element, a set of attributes, and a set of title object security indicia. The apparatus further includes an authorization structure configured to selectively redeem the content element based at least in part on the user security indicia, and further configured to use a set of protocols. The apparatus also includes a title management structure configured to associate a user with the title object based at least in part on the user data and the title attributes.
    Type: Grant
    Filed: May 15, 2003
    Date of Patent: October 12, 2010
    Assignee: Navio Systems, Inc.
    Inventors: Stefan Roever, Kevin Collins, Josh C. Ding, Alex F. Clark, James Bruce
  • Publication number: 20100161444
    Abstract: A method of facilitating a transaction between a merchant and a buyer using a computerized system including a set of titles. The method includes storing the set of titles in a merchant site corresponding to a set of products for sale; browsing the merchant site using a client device and selecting a product for purchase; and generating a payment slip title for the product including information relating to a payment amount and a buyer identifier. The method further includes selecting a payment structure from a set of available payment structures; modifying the payment slip title to include information corresponding to the selected payment structure; releasing the product title to the buyer; and transmitting the payment amount to the merchant.
    Type: Application
    Filed: March 2, 2010
    Publication date: June 24, 2010
    Applicant: NAVIO SYSTEMS, INC.
    Inventors: Stefan Roever, Kevin Collins, Josh C. Ding, Alex F. Clark, James Bruce
  • Publication number: 20100162408
    Abstract: A title management apparatus resident on a first computer including a memory for storing a control program and data, and a processor for executing the control program and for managing the data. The apparatus includes user data resident in the memory including a set of user security indicia. The apparatus also includes a first title object resident in the memory including a title structure, the title structure further comprising a content element, a set of attributes, and a set of title object security indicia. The apparatus further includes a set of stub objects coupled to the title object, wherein the set of stub objects can further optimize the title structure; an authorization structure configured to selectively redeem the content element based at least in part of the user security indicia; and, a title management structure configured to associate a user with the first title object based at least in part of the user data and the title attributes.
    Type: Application
    Filed: March 3, 2010
    Publication date: June 24, 2010
    Applicant: NAVIO SYSTEMS, INC.
    Inventors: Stefan Roever, Kevin Collins, Josh C. Ding, Alex F. Clark, James Bruce
  • Patent number: 7707066
    Abstract: A method of facilitating a transaction between a merchant and a buyer using a computerized system including a set of titles. The method includes storing the set of titles in a merchant site corresponding to a set of products for sale; browsing the merchant site using a client device and selecting a product for purchase; and generating a payment slip title for the product including information relating to a payment amount and a buyer identifier. The method further includes selecting a payment structure from a set of available payment structures; modifying the payment slip title to include information corresponding to the selected payment structure; releasing the product title to the buyer; and transmitting the payment amount to the merchant.
    Type: Grant
    Filed: April 15, 2003
    Date of Patent: April 27, 2010
    Assignee: Navio Systems, Inc.
    Inventors: Stefan Roever, Kevin Collins, Josh C. Ding, Alex F. Clark, James Bruce
  • Patent number: 7707121
    Abstract: A title management apparatus resident on a first computer including a memory for storing a control program and data, and a processor for executing the control program and for managing the data. The apparatus includes user data resident in the memory including a set of user security indicia. The apparatus also includes a first title object resident in the memory including a title structure, the title structure further comprising a content element, a set of attributes, and a set of title object security indicia. The apparatus further includes a set of stub objects coupled to the title object, wherein the set of stub objects can further optimize the title structure; an authorization structure configured to selectively redeem the content element based at least in part of the user security indicia; and, a title management structure configured to associate a user with the first title object based at least in part of the user data and the title attributes.
    Type: Grant
    Filed: May 15, 2003
    Date of Patent: April 27, 2010
    Assignee: Navio Systems, Inc.
    Inventors: Stefan Roever, Kevin Collins, Josh C. Ding, Alex F. Clark, James Bruce
  • Publication number: 20070248257
    Abstract: An automated system for analyzing mask defects in a semiconductor manufacturing process is presented. This system combines results from an inspection tool and design layout data from a design data repository corresponding to each mask layer being inspected with a computer program and a predetermined rule set to determine when a defect on a given mask layer has occurred. Mask inspection results include the presence, location and type (clear or opaque) of defects. Ultimately, a determination is made as to whether to scrap, repair or accept a given mask based on whether the defect would be likely to cause product failure. Application of the defect inspection data to the design layout data for each mask layer being inspected prevents otherwise acceptable wafer masks from being scrapped when the identified defects are not in critical areas of the mask.
    Type: Application
    Filed: June 27, 2007
    Publication date: October 25, 2007
    Applicant: INTERNATIONAL BUSINESS MACHINES CORPORATION
    Inventors: James BRUCE, Orest BULA, Edward CONRAD, William LEIPOLD, Michael HIBBS, Joshua KRUEGER
  • Publication number: 20070237384
    Abstract: An automated system for analyzing mask defects in a semiconductor manufacturing process is presented. This system combines results from an inspection tool and design layout data from a design data repository corresponding to each mask layer being inspected with a computer program and a predetermined rule set to determine when a defect on a given mask layer has occurred. Mask inspection results include the presence, location and type (clear or opaque) of defects. Ultimately, a determination is made as to whether to scrap, repair or accept a given mask based on whether the defect would be likely to cause product failure. Application of the defect inspection data to the design layout data for each mask layer being inspected prevents otherwise acceptable wafer masks from being scrapped when the identified defects are not in critical areas of the mask.
    Type: Application
    Filed: June 12, 2007
    Publication date: October 11, 2007
    Applicant: INTERNATIONAL BUSINESS MACHINES CORPORATION
    Inventors: James BRUCE, Orest BULA, Edward CONRAD, William LEIPOLD, Michael HIBBS, Joshua KRUEGER
  • Publication number: 20070184488
    Abstract: The present invention provides synthetic ?-secretase peptide substrates useful in various assays for measuring ?-secretase activity. Antibodies that recognize the synthetic substrates and uses of the antibodies in various assays are disclosed. The herein disclosed peptide substrates are hydrolyzed at rates substantially faster than the attendant Swedish mutant APP from which the substrate sequences are derived.
    Type: Application
    Filed: September 19, 2006
    Publication date: August 9, 2007
    Inventors: Stephen Brady, James Bruce, Elizabeth Chen-Dodson, Victor Garsky, Yueming Li, Mohinder Sardana, Jules Shafer, Xiaoting Tang
  • Publication number: 20070160526
    Abstract: There are disclosed aptamer ligands to MUC1, preferably comprising a sequence selected from: ?1 CGAATGGGCCCGTCCTCGCTGTAAG ?2 GCAACAGGGTATCCAAAGGATCAAA ?3 GTTCGACAGGAGGCTCACAACAGGC ?4 TGTTGGTCAGGCGGCGGCTCTACAT ?5 CTCTGTTCTTATTTGCGAGTTXXXX ?6 XCTCTGTTCTTATTTGCGAGTTXXX ?7 XXCTCTGTTCTTATTTGCGAGTTXX ?8 XXXCTCTGTTCTTATTTGCGAGTTX ?9 XXXXCTCTGTTCTTATTTGCGAGTT 10 CTCTGTTCTTATTTGCGAGTT 11 CCCTCTGTTCTTATTTGCGAGTTCA 12 CTCTGTTCTTATTTGCGAGTTGGTG 13 CCCTCTGTTCTTATTTGCGAGTTCA 14 TAAGAACAGGGCGTCGTGTTACGAG 15 GTGGCTTACTGCGAGGACGGGCCCA 16 GCAGTTGATCCTTTGGATACCCTGG 17 AACCCTATCCACTTTTCGGCTCGGG 18 CGATTTAGTCTCTGTCTCTAGGGGT 19 CGACAGGAGGCTCACAACAGGCAAC 20 AGAACGAAGCGTTCGACAGGAGGCT 21 AGAAACACTTGGTATATCGCAGATA 22 GGGAGACAAGAATAAACACTCAACG and compounds comprising these aptamers and sequences.
    Type: Application
    Filed: March 10, 2004
    Publication date: July 12, 2007
    Applicant: The Open University
    Inventors: James Bruce, Sotiris Missailidis, Katalin Borbas, Catia Ferreira
  • Publication number: 20070162300
    Abstract: A method of optimizing a contact management system using a computerized system including a set of titles. The method includes storing a set of user identity records in an identity management site, wherein each record of the set of user identity records can be redeemed by a pointer. The method also includes generating a contact title including the pointer for the record; storing the contact title in a first title management site; selecting the contact title; redeeming the record from the identity management site; and displaying the record.
    Type: Application
    Filed: February 27, 2007
    Publication date: July 12, 2007
    Applicant: Navio Systems, Inc.
    Inventors: Stefan Roever, Kevin Collins, Josh Ding, Alex Clark, James Bruce
  • Publication number: 20060270268
    Abstract: A design verification method, including (a) providing in a design a design electrically conducting line and a design contact region being in direct physical contact with the design electrically conducting line; (b) modeling a simulated electrically conducting line of the design electrically conducting line; (c) simulating a possible contact region of the design contact region, wherein the design contact region and the possible contact region are not identical; and (d) determining that the design electrically conducting line and the design contact region are potentially defective if an interfacing surface area of the simulated electrically conducting line and the possible contact region is less than a pre-specified value.
    Type: Application
    Filed: May 26, 2005
    Publication date: November 30, 2006
    Applicant: INTERNATIONAL BUSINESS MACHINES CORPORATION
    Inventors: James Bruce, James Culp, John Nickel, Jacek Smolinski
  • Publication number: 20060174350
    Abstract: Methods and apparatus are describe for providing access to identity information corresponding to a first entity. The identity information includes a plurality of identity components stored in a distributed manner. A first identity access title object is generated which is operable to confer rights to access first selected ones of the identity components to a presenter of the first identity access title object. The first identity access title object is transmitted to a second entity. Access to the first selected identity components is facilitated in response to presentation of the first identity access title object by the second entity.
    Type: Application
    Filed: April 29, 2005
    Publication date: August 3, 2006
    Inventors: Stefan Roever, Kevin Collins, Alex Clark, James Bruce
  • Publication number: 20060115871
    Abstract: Particular aspects provide novel protein interaction reporter (PIR) compounds (e.g., formulas I and II), comprising at least two protein reactive moieties (e.g., N-hydroxysuccinamide), each linked to a reporter moiety (e.g., mass reporter) by a covalent labile bond that is differentially cleavable with respect to peptide bonds (e.g., by a method such as collisional activation in a mass spectrometer, activation by electron capture dissociation (ECD), photoactivation, etc.), wherein the reporter moiety is operatively releasable from the PIR agent upon cleavage of the labile bonds, the released reporter moiety having a characteristic identifying property or label (e.g., m/z value). Particular PIRs comprise a mass reporter moiety, and further comprise an affinity group, (e.g., biotin), linked to the PIR (e.g., to the mass reporter moiety) by a selectively cleavable bone (e.g. photo-labile bond)).
    Type: Application
    Filed: November 18, 2005
    Publication date: June 1, 2006
    Applicant: Washington State University
    Inventors: James Bruce, Xiaoting Tang, Gerhard Munske