Abstract: A composition for the treatment of bladder fibrosis in a patient in need that includes a miR-29 mimic is disclosed. The miR-29 mimic may include a working RNA strand with the nucleotide sequence UAGCACCAUCUGAAAUCGGUUUU (SEQ ID NO:4) and a passenger RNA strand comprising the nucleotide sequence: AACCGAUUUCuuuUGGUGCUAUU (SEQ ID NO:5). The passenger RNA strand includes a 2?-O-methylation modification to increase stability. Cholesterol is conjugated to the 3?-end of the passenger RNA strand to enhance cellular uptake. The composition may further include a carrier molecule including, but not limited to, branched polyethylenimine at an N/P ratio of 0.8, where N denotes the nitrogens of the polyethylenimine and P denotes the phosphate groups of the working and passenger RNA strands. In some aspects, the composition may be an injectable composition that includes a polyplex dissolved in a 0.5% glucose solution, where the polyplex is formed from the working and passenger RNA strands and the carrier molecule.

Abstract: Among the various aspects of the present disclosure is the provision of miRNA mimics and uses thereof. An aspect of the present disclosure provides for compositions of miRNA mimic molecules and methods of treating metabolic disorders using miRNA mimic molecules.

Abstract: Among the various aspects of the present disclosure is the provision of a blood brain barrier (BBB) opening agent and uses thereof. An aspect of the present disclosure provides for methods of opening up the BBB; increasing the permeability of the tricellular junction; and using a BBB opening agent for the treatment of a brain pathology or neurological disease, disorder, or condition.

Abstract: Methods of detecting, diagnosing, monitoring and treating kidney stones are disclosed. In some embodiments, methods of detecting, diagnosing or monitoring kidney stones comprise contacting a urine sample with anti-Claudin-14 antibody, and detecting quantity of a complex comprising Claudin-14 and the antibody, wherein an increase compared to control levels is diagnostic for kidney stones. In some embodiments, methods further comprise testing a second sample at a second time point to detect increased kidney stones. In some embodiments, methods of treating kidney stone disease comprise administering an miR-9 mimic or an miR-374 mimic. In some embodiments, methods comprise administering an inhibitor of CaSR signaling. In some embodiments, methods comprise administering a HDAC inhibitor. In some embodiments methods of treating hyperparathyroidism and hypercalcemia are disclosed, comprising administering an agonist of CaSR.