Abstract: The invention provides an immunostimulatory nucleic acid comprising CpG motifs, and methods of use thereof in stimulating immunity.

Abstract: Immunostimulatory polymers that contain certain sequence-dependent immunostimulatory RNA motifs and methods for the use of such immunostimulatory polymers and compositions containing such polymers are provided according to the invention. The sequence-dependent immunostimulatory RNA motifs and the polymers incorporating such motifs are potent and selective inducers of TLR7 and the TLR7-associated cytokine IFN-?.

Abstract: The invention relates to specific C-Class semi-soft CpG immunostimulatory oligonucleotides that are useful for stimulating an immune response. In particular the oligonucleotides are useful for treating allergy, such as allergic rhinitis and asthma, cancer and infectious disease, such as hepatitis B and hepatitis C.

Abstract: The invention relates to methods and products for the treatment of viral infection using a combination of anti-viral agents and TLR ligands. The invention also relates to screening assays, associated products, kits, and in vitro methods.

Abstract: The invention relates to a nucleic acid-lipophilic conjugates and methods for modulating an immune response using the conjugates. The lipophilic moiety associated with an immunostimulatory nucleic acid.

Abstract: The invention relates to immunostimulatory RNA oligonucleotides (ORN). In particular the ORN have an immunostimulatory ORN motif directly or indirectly flanked by a 3? poly G motif and optionally a 5? poly-G motif. The invention also relates to methods including therapeutic methods and screening methods and related kits for use of the ORN.

Abstract: The invention provides immunostimulatory compositions and use of those compounds in the preparation of medicaments for the treatment of disease as well as in vitro uses. In particular, the compositions of the invention include immunostimulatory oligoribonucleotides that incorporate a sequence-dependent immunostimulatory sequence motif. Specific modifications involving phosphate linkages, nucleotide analogs, adducts, and combinations thereof are provided. Compositions of the invention, which optionally can include an antigen, can be used alone or together with other treatments to stimulate or enhance an immune response. Also provided are compositions and methods useful for treating a subject having an infection, a cancer, an allergic condition, asthma, airway remodeling, or immunodeficiency. Immunostimulatory oligoribonucleotides of the invention are believed to stimulate Toll-like receptor 8 (TLR8).

Abstract: The invention relates to a nucleic acid-lipophilic conjugates and methods for modulating an immune response using the conjugates. The lipophilic moiety associated with an immunostimulatory nucleic acid.

Abstract: The invention relates to immunostimulatory nucleic acid compositions and methods of using the compositions. The T-rich nucleic acids contain poly T sequences and/or have greater than 25% T nucleotide residues. The TG nucleic acids have TG dinucleotides. The C-rich nucleic acids have at least one poly-C region and/ore greater than 50% c nucleotides. These immunostimulatory nucleic acids function in a similar manner to nucleic acids containing CpG motifs. The invention also encompasses preferred CpG nucleic acids.

Abstract: The invention relates to specific C-Class semi-soft CpG immunostimulatory oligonucleotides that are useful for stimulating an immune response. In particular the oligonucleotides are useful for treating allergy, such as allergic rhinitis and asthma, cancer and infectious disease, such as hepatitis B and hepatitis C.

Abstract: The invention relates to specific C-Class semi-soft CpG immunostimulatory oligonucleotides that are useful for stimulating an immune response. In particular the oligonucleotides are useful for treating allergy, such as allergic rhinitis and asthma, cancer and infectious disease, such as hepatitis B and hepatitis C.

Abstract: Immunostimulatory oligonucleotides, which contain a CpG immunostimulatory motif and a second motif that is capable of forming secondary structure, including duplex and higher order structures in vitro and in vivo, are disclosed. They include nucleic acids, or pharmaceutically acceptable salts thereof, having base sequences that include 5? TCGTCGTTTTCGGCGCGCGCCGT 3? (SEQ ID NO: 1), in which each C is unmethylated and 3? refers to the 3? end of the nucleic acid. The oligonucleotides activate B cells and NK cells and induce expression of type I interferon and interferon-?. The oligonucleotides are useful for treating a variety of disorders and conditions, including allergy, asthma, infection, and cancer. In addition to their use as single agents and as combination therapies, the disclosed oligonucleotides are useful as adjuvants in vaccines.

Abstract: Immunostimulatory compositions described as CpG-like nucleic acids are provided, including nucleic acids having immunostimulatory characteristics of CpG nucleic acid, despite certain substitutions of C, G, or C and G of the CpG dinucleotide. The substitutions can include, among others, exchange of methylated C for C, inosine for G, and ZpY for CpG, where Z is cytosine or dSpacer and Y is inosine, 2-aminopurine, nebularine, or dSpacer. Also provided are methods for inducing an immune response in a subject using the CpG-like nucleic acids. The methods are useful in the treatment of a subject that has or is at risk of developing an infectious disease, allergy, asthma, cancer, anemia, thrombocytopenia, or neutropenia.

Abstract: The present invention relates generally to immunostimulatory nucleic acids, compositions thereof and methods of using the immunostimulatory nucleic acids. In particular the invention relates to palindrome-containing immunostimulatory nucleic acids and the use of these nucleic acids in treating disease.

Abstract: The invention relates to a class of short CpG immunostimulatory oligonucleotides that are useful for stimulating an immune response. Preferably the short oligonucleotides are soft or semi-soft oligonucleotides.

Abstract: The invention relates to a class of soft or semi-soft CpG immunostimulatory oligonucleotides that are useful for stimulating an immune response.

Abstract: The invention relates to immunostimulatory nucleic acid compositions and methods of using the compositions. The T-rich nucleic acids contain poly T sequences and/or have greater than 25% T nucleotide residues. The TG nucleic acids have TG dinucleotides. The C-rich nucleic acids have at least one poly-C region and/ore greater than 50% c nucleotides. These immunostimulatory nucleic acids function in a similar manner to nucleic acids containing CpG motifs. The invention also encompasses preferred CpG nucleic acids.

Abstract: The invention provides immunostimulatory compositions and use of those compounds in the preparation of medicaments for the treatment of disease as well as in vitro uses. In particular, the compositions of the invention include immunostimulatory oligoribonucleotides that incorporate a sequence-dependent immunostimulatory sequence motif. Specific modifications involving phosphate linkages, nucleotide analogs, adducts, and combinations thereof are provided. Compositions of the invention, which optionally can include an antigen, can be used alone or together with other treatments to stimulate or enhance an immune response. Also provided are compositions and methods useful for treating a subject having an infection, a cancer, an allergic condition, asthma, airway remodeling, or immunodeficiency. Immunostimulatory oligoribonucleotides of the invention are believed to stimulate Toll-like receptor 8 (TLR8).

Abstract: The invention relates to immunostimulatory nucleic acid compositions and methods of using the compositions. The T-rich nucleic acids contain poly T sequences and/or have greater than 25% T nucleotide residues. The TG nucleic acids have TG dinucleotides. The C-rich nucleic acids have at least one poly-C region and/ore greater than 50% c nucleotides. These immunostimulatory nucleic acids function in a similar manner to nucleic acids containing CpG motifs. The invention also encompasses preferred CpG nucleic acids.

Abstract: The invention provides methods for identifying and treating subjects having hepatitis C infections. In some instances, the subjects are those that are non-responsive to non-CpG therapy. Preferably, the subjects are treated with C class CpG immunostimulatory nucleic acids having a semi-soft backbone.