Abstract: The present invention provides agents for regulating the activity of interferon-producing cells (IPCs), which comprise as active ingredients antibodies that bind to BST2 and/or to its homologues, and methods for regulating IPC activity that use these antibodies. According to the present invention, the ability of IPCs to produce interferons (IFNs) and the number of cells can be directly regulated. The present invention also provides uses of BST2 and/or its homologues as markers for IPC activation. Compounds that regulate IPC activation can be screened using the markers for IPC activation.

Abstract: An imaging apparatus may include an infrared cutoff filter capable of being inserted into and extracted from an incident light path to an image sensing device, and may further include a first detecting unit configured to, when the infrared cutoff filter is off the incident light path to the image sensing device, detect whether the difference between current illuminance of a subject acquired from an image signal of the subject sensed by the image sensing device and a reference value of the illuminance of the subject determined after the infrared cutoff filter was extracted is equal to or greater than a first threshold value, and a filter control unit configured to, when the first detecting unit detects that the difference between the current illuminance and the reference value is equal to or greater than the first threshold value, insert the infrared cutoff filter into the incident light path.

Abstract: The present invention provides agents for regulating the activity of interferon-producing cells (IPCs), which comprise as active ingredients antibodies that bind to BST2 and/or to its homologues, and methods for regulating IPC activity that use these antibodies. According to the present invention, the ability of IPCs to produce interferons (IFNs) and the number of cells can be directly regulated. The present invention also provides uses of BST2 and/or its homologues as markers for IPC activation. Compounds that regulate IPC activation can be screened using the markers for IPC activation.

Abstract: An imaging apparatus may include an infrared cutoff filter capable of being inserted into and extracted from an incident light path to an image sensing device, and may further include a first detecting unit configured to, when the infrared cutoff filter is off the incident light path to the image sensing device, detect whether the difference between current illuminance of a subject acquired from an image signal of the subject sensed by the image sensing device and a reference value of the illuminance of the subject determined after the infrared cutoff filter was extracted is equal to or greater than a first threshold value, and a filter control unit configured to, when the first detecting unit detects that the difference between the current illuminance and the reference value is equal to or greater than the first threshold value, insert the infrared cutoff filter into the incident light path.

Abstract: Disclosed herein is a lens actuating device and an image pickup apparatus which are capable of actuating a lens to a proper lens position. Each one of the lens actuating device and the image pickup apparatus includes: a lens; an actuating unit for actuating the lens; a detecting unit for detecting a reference position of the lens; and an initialization control unit for moving the lens to the reference position detected by the detecting unit in each predetermined period of time, thereby to initialize the position of the lens.

Abstract: A ribozyme comprising the following base sequence (I) or (II): base sequence (I)(SEQ ID No. 1): 5′-ACCGUUGGUUUCCGUAGUGUAGU GGUUAUCACGUUCGCCUAACACGCGAAAGGUCCCCGGUUCGAAACCGGGCACU ACAAACACAACACUGAUGAGGACCGAAAGGUCCGAAACGGGCACGUCGGAAACG GUUUU[[U]]-3′ base sequence (II)(SEQ ID No. 2): 5′-ACCGUUGGUUUCCGUAGUGUAGUGG UUAUCACGUUCGCCUAACACGCGAAAGGUCCCCGGUUCGAAACCGGGCACUACAAA CCAACACACAACACUGAUGAGGACCGAAAGGUCCGAAACGGGCACGUCGGAAACGG UUUU[[U]]-3′.

Abstract: The automatic tracking/image sensing device includes a lens barrel for supporting an image sensing lens, a support mechanism for supporting the lens barrel in such a way that the lens barrel can be moved, driver for driving the lens barrel, an image sensor installed at a location in close proximity to an image created by the image sensing lens, a video signal processor for generating a video signal based on a signal output by the image sensor, an object position detector for computing a positional deviation from the current position of the object to the center of the screen in accordance with the video signal generated by the video signal processor, a deflection detecting sensor for detecting the deflection of the lens barrel and a lens barrel posture controller for adjusting the angle of the lens barrel by using a driver in accordance with the positional deviation and the deflection.

Abstract: A resin-based composition for casting artificial marble has excellent resistance to hot water. The composition includes an unsaturated polyester resin and a gibbsite-type aluminum hydroxide which has been surface-treated with an ethylenically unsaturated silane coupling agent.