Abstract: The present invention provides a simple method for producing a dumbbell-shaped DNA.

Abstract: The present invention relates to cancer therapies using an antibody that binds to mortalin 2 and a functional nucleic acid. Mortalin expression was found to be upregulated in immortalized cells and tumor tissues. Immortalized human cells highly expressing mortalin showed anchorage-independent growth. When the K antibody, which is a specific anti-mortalin antibody, was injected into a tumor of a nude mouse, tumor growth was suppressed or the tumor shrank compared with the case of a control. In accordance with the present invention, the use of a specific anti-mortalin antibody (K antibody) for tumor therapies and the use of such antibody as a carrier molecule for transportation of immunotoxicin and the like into cells are provided. It has been shown that mortalin can be a target for cancer therapies. In accordance with the present invention, a novel and effective anticancer agent is provided. In addition, an anti-mortalin antibody that is internalized by cells is developed.

Abstract: The present invention relates to cancer therapies using an antibody that binds to mortalin 2 and a functional nucleic acid. Mortalin expression was found to be upregulated in immortalized cells and tumor tissues. Immortalized human cells highly expressing mortalin showed anchorage-independent growth. When the K antibody, which is a specific anti-mortalin antibody, was injected into a tumor of a nude mouse, tumor growth was suppressed or the tumor shrank compared with the case of a control. In accordance with the present invention, the use of a specific anti-mortalin antibody (K antibody) for tumor therapies and the use of such antibody as a carrier molecule for transportation of immunotoxicin and the like into cells are provided. It has been shown that mortalin can be a target for cancer therapies. In accordance with the present invention, a novel and effective anticancer agent is provided. In addition, an anti-mortalin antibody that is internalized by cells is developed.

Abstract: The present invention is to provide: a double-stranded RNA (siRNA) capable of suppressing expression of Skp-2 gene, a double-stranded RNA expression cassette capable of expressing a double-stranded RNA, a double-stranded RNA expression vector containing a double-stranded RNA expression cassette, and highly safe therapeutic drug and therapy specific to cancers such as small cell lung cancer having Skp-2 as a molecular target. The RNAi target sequence is set in a plurality of sites in the protein translation region of Skp-2 mRNA, the expressed siRNA, which is a dsRNA exhibiting RNAi effect, is constructed on a lentiviral vector to construct a recombinant viral vector, and various small cell lung cancer cell lines and small cell lung cancers are infected with this viral vector, to confirm the cell proliferation suppression effect in vitro and the proliferation suppression effect in vivo.

Abstract: The present invention provides a simple method for producing a dumbbell-shaped DNA.

Abstract: The present invention provides products and methods for modulating expression of a target gene in a cell. One such method includes introducing into the cell a polynucleotide that forms a duplex region with an mRNA transcribed from said target gene, where the duplex region comprises a mammalian miRNA target region. Another such method includes introducing into the cell an siRNA that forms a duplex region with an miRNA, or precursor thereof, where an mRNA transcribed from the target gene comprises a miRNA target region. In certain preferred embodiments, the methods further include measuring expression of the target gene. The methods are particularly useful for modulating ontogenesis, function, differentiation and/or viability of a mammalian cell.

Abstract: A method of inhibiting the replication ability of a hepatitis C virus (HCV) is provided. An oligoribonucleotide or a peptide nucleic acid which sequence-specifically binds to the HCV-RNA, and a therapeutic agent for hepatitis C which contains any of these components as an active ingredient are provided.

Abstract: The present inventors discovered that an RNA molecule can be efficiently transferred into cytoplasm and exert RNAi effects, by producing a stem loop RNA molecule from the DNA that encodes this RNA molecule, with the use of a tRNA promoter. Also, the RNAi effects can be exerted effectively, by introducing a cytoplasm translocation signal sequence into the DNA that encodes a stem loop RNA molecule. Moreover, the RNAi effects can be exerted effectively by transferring a transcriptional product into the cytoplasm, using a pol II-type promoter. In this case, cytotoxicity can be reduced by co-expressing a Dicer gene. Furthermore, an effective dsRNA can be constructed by treating a dsRNA or a stem loop RNA molecule with Dicer protein. Knockout cells lacking a gene of interest can be conveniently constructed, using these stem-loop RNA molecule expression systems.

Abstract: The present inventors found that in human cells, synthetic small interfering RNAs (siRNAs) targeted to a region containing the CpG islands on gene promoters will specifically induce the methylation of CpG sequences within the target region or adjacent regions. Methylation of the promoters results in suppression at a transcriptional level of expression of genes downstream of the promoters. The present invention provides methods for inducing DNA methylation using the siRNAs, and methods for suppressing gene expression based on siRNA-directed methylation of promoters. The present invention also provides DNA methylation-inducing agents or gene expression-suppressing agents that comprise siRNAs or expression vectors for the siRNAs or dsRNAs.

Abstract: The in vivo siRNA expression system according to this invention is a system that intracellularly expresses small interfering (si) RNAs and comprises antisense and sense code DNAs coding for antisense and sense RNAs targeting any region of a target gene mRNA and one or more promoters that function to express the antisense and sense RNAs from the antisense and sense code DNAS, respectively.

Abstract: A stable linkage between a genotype and a phenotype in a cell-free system was successfully achieved by using interaction between a RNA-binding protein and RNA, between a DNA-binding protein and DNA, or by using a protein that inactivates a ribosome. Furthermore, it was found that functional proteins could be selected by using these stable linkages.

Abstract: A double-stranded RNA comprising an antisense RNA and a sense RNA with specific mutations are disclosed as having enhanced RNAi activities. The double stranded RNA has at least one substitution or insertion mutation introduced at a first, second or third nucleotide position from the 5? end of the antisense RNA or at 17-19 position as counted from the 3? end of the antisense sequence excluding an overhang, and the antisense RNA is complementary to a region of an mRNA of a target gene except the at least one substitution or insertion mutation. Related single-strand RNAs, vectors, methods, cells and compositions are disclosed.

Abstract: By inhibiting expression of a normal prion protein in prion-infected cells by using siRNA, it is possible to inhibit accumulation of an abnormal prion protein consequently. The inhibition of the abnormal prion protein accumulation can be applied in prevention and treatment of the prion diseases. This provides a method of inhibiting the abnormal prion protein accumulation. This method is applicable in preventing and treating the prion diseases whose effective method of treating has not been established at this moment. Further, use of this method is provided herein.

Abstract: The in vivo siRNA expression system according to this invention is a system that intracellularly expresses small interfering (si) RNAs and comprises antisense and sense code DNAs coding for antisense and sense RNAs targeting any region of a target gene mRNA and one or more promoters that function to express the antisense and sense RNAs from the antisense and sense code DNAs, respectively.

Abstract: The present invention relates to a therapeutic method using RNAi directed at BRAF, of which the point mutation, especially V599E, occurs frequently in melanomas. RNAi specific for the mutated BRAF will provide a specific therapeutic intervention for cancers such as malignant melanoma. Several target sequences for RNAi were selected in the protein coding region of the BRAF mRNA. The short hairpin RNA expression cassette was constructed on the lentiviral vector. One recombinant viral vector for the mutated BRAF V599E and two other vectors sites for wild type BRAF were constructed to infect various malignant melanoma cell lines, and the effects on the growth inhibition and the signaling of MAPK pathway were examined. The inhibitory effect on the invasion ability of malignant melanoma cell line and in vivo growth of a malignant melanoma cell line were examined.

Abstract: An object of the present invention is to provide a maxizyme that can bind to a target mRNA regardless of its conformation, and can effectively cleave the mRNA. The present invention provides a maxizyme which binds to a molecule having helicase activity.

Abstract: A ribozyme comprising the following base sequence (I) or (II): 1 base sequence (I)(SEQ ID No. 1): 5′-ACCGUUGGUUUCCGUAGUGUAGUGGUUAUCACGUUCGCCUAACACGC GAAAGGUCCCCGGUUCGAAACCGGGCACUACAAACACAACACUGAUGAGG ACCGAAAGGUCCGAAACGGGCACGUCGGAAACGGUUUU[[U]]-3′ base sequence (II)(SEQ ID No. 2): 5′-ACCGUUGGUUUCCGUAGUGUAGUGGUUAUCACGUUCGCCUAACACGC GAAAGGUCCCCGGUUCGAAACCGGGCACUACAAACCAACACACAACACUG AUGAGGACCGAAAGGUCCGAAACGGGCACGUCGGAAACGGUUU U[[U]]-3′.

Abstract: A ribozyme comprising the following base sequence (I) or (II): base sequence (I)(SEQ ID No. 1): 5′-ACCGUUGGUUUCCGUAGUGUAGU GGUUAUCACGUUCGCCUAACACGCGAAAGGUCCCCGGUUCGAAACCGGGCACU ACAAACACAACACUGAUGAGGACCGAAAGGUCCGAAACGGGCACGUCGGAAACG GUUUU[[U]]-3′ base sequence (II)(SEQ ID No. 2): 5′-ACCGUUGGUUUCCGUAGUGUAGUGG UUAUCACGUUCGCCUAACACGCGAAAGGUCCCCGGUUCGAAACCGGGCACUACAAA CCAACACACAACACUGAUGAGGACCGAAAGGUCCGAAACGGGCACGUCGGAAACGG UUUU[[U]]-3′.

Abstract: The in vivo siRNA expression system according to this invention is a system that intracellularly expresses small interfering (si) RNAs and comprises antisense and sense code DNAs coding for antisense and sense RNAs targeting any region of a target gene mRNA and one or more promoters that function to express the antisense and sense RNAs from the antisense and sense code DNAs, respectively.

Abstract: This invention relates to a chimeric molecule comprising a region with binding affinity for a molecule capable of sliding and any functional region; a chimeric molecule comprising a molecule capable of sliding and any functional region; a chimeric molecule comprising a region with binding affinity for a molecule forming a complex with a molecule capable of sliding, and any functional region; a chimeric molecule comprising a protein capable of sliding and any functional nucleic acid; a chimeric molecule comprising a nucleic acid with binding affinity for a protein capable of sliding or a nucleic acid with binding affinity for a molecule forming a complex with said protein, and any functional nucleic acid; a vector comprising DNA encoding the chimeric molecule; and use thereof in medicaments, etc.