Patents by Inventor Kenichi Tsukumo

Kenichi Tsukumo has filed for patents to protect the following inventions. This listing includes patent applications that are pending as well as patents that have already been granted by the United States Patent and Trademark Office (USPTO).

  • Method and kit for detecting methicillin-resistant Staphylococcus aureus
    Patent number: 5702895
    Abstract: A method and a kit for detecting methicillin-resistant Staphylococcus aureus which use, as primers in a gene amplification reaction, the four oligonucleotides represented by the following nucleotide sequences (1) through (4):5'AGAAATGACTGAACGTCCG3' (SEQ ID NO:1) (1)5'GCGATCAATGTTACCGTAG3' (SEQ ID NO:2) (2)5'TACATGTCGTTAAACCTGGTG3' (SEQ ID NO:3) (3)5'TACAGTTGTACCGATGAATGG3' (SEQ ID NO:4) (4)wherein A, G, C, and T denote adenine, guanine, cytosine, and thymine, respectively, and any T may be substituted by uracil (U). According to the method and kit of the present invention, it is possible to detect MRSA accurately and rapidly while distinguishing it from MR-CNS. Thus, proper treatment and prevention can be achieved against MRSA infections.
    Type: Grant
    Filed: January 16, 1996
    Date of Patent: December 30, 1997
    Assignee: Wakunaga Seiyaku Kabushiki Kaisha
    Inventors: Hironari Matsunaga, Kenichi Tsukumo, Shinji Wakisaka, Akio Yamane