Patents by Inventor Kimiko Ubukata

Kimiko Ubukata has filed for patents to protect the following inventions. This listing includes patent applications that are pending as well as patents that have already been granted by the United States Patent and Trademark Office (USPTO).

  • Detection for Staphylococcus spp.
    Patent number: 5437978
    Abstract: The present invention discloses a primer for detecting methicillin-resistant or toxic shock syndrome toxin-1 Staphylococcus spp. comprising any one of nucleotide fragments of sequences (1) to (4):5'GAAATGACTGAACGTCCGAT (1)5'GCGATCAATGTTACCGTAGT (2)5'AGTATGGGCCAAAGTTCGAT (3)5'CACTTTGATATGTGGATCCG (4)a method and kit for detecting these bacteria using the primer. The present invention makes direct and rapid detection of MRS and/or TPS from samples possible, and enables patients with infections caused by these bacteria to be treated at an early stage.
    Type: Grant
    Filed: August 4, 1992
    Date of Patent: August 1, 1995
    Assignee: Wakunaga Seiyaku Kabushiki Kaisha
    Inventors: Kimiko Ubukata, Satoru Nakagami, Akio Yamane