Patents by Inventor Laura Cerchia

Laura Cerchia has filed for patents to protect the following inventions. This listing includes patent applications that are pending as well as patents that have already been granted by the United States Patent and Trademark Office (USPTO).

  • Patent number: 9234202
    Abstract: Nuclease-resistant RNA aptamers are provided which are capable of neutralizing PDGFR? and are therefore useful in the diagnosis and/or therapy of PDGFR?-associated and hyperproliferative-associated diseases, such as cancer and primary tumor metastasis. RNA aptamers provided herein include a modified synthetic RNA sequence wherein at least one pyrimidine residue is modified to 2?-fluoropyrimidine. Pharmaceutical compositions and diagnostic kits comprising RNA aptamers are also provided.
    Type: Grant
    Filed: October 4, 2013
    Date of Patent: January 12, 2016
    Assignee: CONSIGLIO NAZIONALE DELLE RICERCHE
    Inventors: Laura Cerchia, Gerolama Condorelli, Vittorio De Franciscis
  • Publication number: 20150275215
    Abstract: Nuclease-resistant RNA aptamers are provided which are capable of neutralizing PDGFR? and are therefore useful in the diagnosis and/or therapy of PDGFR?-associated and hyperproliferative-associated diseases, such as cancer and primary tumour metastasis. RNA aptamers provided herein include a modified synthetic RNA sequence wherein at least one pyrimidine residue is modified to 2?-fluoropyrimidine. Pharmaceutical compositions and diagnostic kits comprising RNA aptamers are also provided.
    Type: Application
    Filed: October 4, 2013
    Publication date: October 1, 2015
    Inventors: Laura Cerchia, Gerolama Condorelli, Vittorio De Franciscis
  • Patent number: 9125930
    Abstract: The present invention concerns a nucleotide aptamer having the sequence 5? GCCUUAGUAACGUGCUUUGAUGUCGAUUCGACAGGAGGC3? (SEQ ID No. 1) for use in the treatment and/or prevention and/or diagnosis of an EGFR induced disorder and a pharmaceutical composition comprising the same. The invention also relates to a method for the diagnosis of a EGFR induced disorder in a patient from which a sample is obtained and relative diagnostic kit.
    Type: Grant
    Filed: October 10, 2011
    Date of Patent: September 8, 2015
    Assignee: CONSIGLIO NAZIONALE DELLE RICERCHE
    Inventors: Vittorio De Franciscis, Laura Cerchia
  • Patent number: 8741870
    Abstract: The present invention concerns a nucleotide aptamer having the sequence: 5?-AUGAUCAAUCGCCUCAAUUCGACAGGAGGCUCAC-3?(SEQ ID NO: 1) for use in the treatment and/or prevention and/or diagnosis of an Axl receptor tyrosine kinase induced disorder and a pharmaceutical composition comprising the same. The invention also relates to a method for the diagnosis of an Axl receptor tyrosine kinase induced disorder in a patient from which a sample is obtained and related diagnostic kit.
    Type: Grant
    Filed: October 10, 2011
    Date of Patent: June 3, 2014
    Assignee: Consiglio Nazionale delle Ricerche
    Inventors: Vittorio De Franciscis, Laura Cerchia
  • Publication number: 20130197070
    Abstract: The present invention concerns a nucleotide aptamer having the sequence: 5?-AUGAUCAAUCGCCUCAAUUCGACAGGAGGCUCAC-3?(SEQ ID NO: 1) for use in the treatment and/or prevention and/or diagnosis of an Axl receptor tyrosine kinase induced disorder and a pharmaceutical composition comprising the same. The invention also relates to a method for the diagnosis of an Axl receptor tyrosine kinase induced disorder in a patient from which a sample is obtained and related diagnostic kit.
    Type: Application
    Filed: October 10, 2011
    Publication date: August 1, 2013
    Applicant: CNR - CONSIGLIO NAZIONALE DELLE RICERCHE
    Inventors: Vittorio De Franciscis, Laura Cerchia
  • Patent number: 8492082
    Abstract: The present invention relates to a method for obtaining nucleic acid aptamers that bind to cancer cell-surface epitopes, to the aptamers generated using this method and their use for therapeutic, diagnostic and prognostic purposes.
    Type: Grant
    Filed: September 1, 2009
    Date of Patent: July 23, 2013
    Assignee: Consiglio Nazionale delle Richerche
    Inventors: Vittorio De Franciscis, Laura Cerchia, Gerolama Condorelli
  • Publication number: 20130177556
    Abstract: The present invention concerns a nucleotide aptamer having the sequence 5? GCCUUAGUAACGUGCUUUGAUGUCGAUUCGACAGGAGGC3? (SEQ ID No. 1) for use in the treatment and/or prevention and/or diagnosis of an EGFR induced disorder and a pharmaceutical composition comprising the same. The invention also relates to a method for the diagnosis of a EGFR induced disorder in a patient from which a sample is obtained and relative diagnostic kit.
    Type: Application
    Filed: October 10, 2011
    Publication date: July 11, 2013
    Applicant: CNR - CONSIGLIO NAZIONALE DELLE RICERCHE
    Inventors: Vittorio De Franciscis, Laura Cerchia
  • Publication number: 20110166213
    Abstract: The present invention relates to a method for obtaining nucleic acid aptamers that bind to cancer cell-surface epitopes, to the aptamers generated using this method and their use for therapeutic, diagnostic and prognostic purposes.
    Type: Application
    Filed: September 1, 2009
    Publication date: July 7, 2011
    Applicant: CONSIGLIO NAZIONALE DELLE RICERCHE
    Inventors: Vittorio De Franciscis, Laura Cerchia, Gerolama Condorelli
  • Publication number: 20080227735
    Abstract: The invention relates to aptamers selected from live tumor cells and to the use thereof for diagnosis and treatment of certain cancers and other pathologies.
    Type: Application
    Filed: March 17, 2005
    Publication date: September 18, 2008
    Applicant: COMMISSARIAT A L'ENERGIE ATOMIQUE
    Inventors: Bertrand Tavitian, Frederic Duconge, Domenico Libri, Vittorio De Franciscis, Laura Cerchia