Abstract: Compositions containing quaternary compounds in which the nitrogen atom is substituted by at least one alkyl group having at least 12 carbon atoms, and the composition includes at least 20% in weight by weight of the total composition, of ammonium halides in which the nitrogen atom is substituted by at least one alkyl group having at least 14 carbon atoms and more than 5%, preferably more than 7% in weight by weight of the total composition, of ammonium halides in which the nitrogen atom is substituted by at least one alkyl group having at least 16 carbon atoms. Also, ophthalmic oil-in-water emulsions containing such compositions, the ophthalmic emulsions being useful for eye care or for the treatment of eye conditions.

Abstract: Compositions containing quaternary compounds in which the nitrogen atom is substituted by at least one alkyl group having at least 12 carbon atoms, and the composition includes at least 20% in weight by weight of the total composition, of ammonium halides in which the nitrogen atom is substituted by at least one alkyl group having at least 14 carbon atoms and more than 5%, preferably more than 7% in weight by weight of the total composition, of ammonium halides in which the nitrogen atom is substituted by at least one alkyl group having at least 16 carbon atoms. Also, ophthalmic oil-in-water emulsions containing such compositions, the ophthalmic emulsions being useful for eye care or for the treatment of eye conditions.

Abstract: Compositions containing quaternary compounds in which the nitrogen atom is substituted by at least one alkyl group having at least 12 carbon atoms, and the composition includes at least 20% in weight by weight of the total composition, of ammonium halides in which the nitrogen atom is substituted by at least one alkyl group having at least 14 carbon atoms and more than 5%, preferably more than 7% in weight by weight of the total composition, of ammonium halides in which the nitrogen atom is substituted by at least one alkyl group having at least 16 carbon atoms. Also, ophthalmic oil-in-water emulsions containing such compositions, the ophthalmic emulsions being useful for eye care or for the treatment of eye conditions.

Abstract: Compositions containing quaternary compounds in which the nitrogen atom is substituted by at least one alkyl group having at least 12 carbon atoms, and the composition includes at least 20% in weight by weight of the total composition, of ammonium halides in which the nitrogen atom is substituted by at least one alkyl group having at least 14 carbon atoms and more than 5%, preferably more than 7% in weight by weight of the total composition, of ammonium halides in which the nitrogen atom is substituted by at least one alkyl group having at least 16 carbon atoms. Also, ophthalmic oil-in-water emulsions containing such compositions, the ophthalmic emulsions being useful for eye care or for the treatment of eye conditions.

Abstract: Compositions containing quaternary compounds in which the nitrogen atom is substituted by at least one alkyl group having at least 12 carbon atoms, and the composition includes at least 20% in weight by weight of the total composition, of ammonium halides in which the nitrogen atom is substituted by at least one alkyl group having at least 14 carbon atoms and more than 5%, preferably more than 7% in weight by weight of the total composition, of ammonium halides in which the nitrogen atom is substituted by at least one alkyl group having at least 16 carbon atoms. Also, ophthalmic oil-in-water emulsions containing such compositions, the ophthalmic emulsions being useful for eye care or for the treatment of eye conditions.

Abstract: Compositions containing quaternary compounds in which the nitrogen atom is substituted by at least one alkyl group having at least 12 carbon atoms, and the composition includes at least 20% in weight by weight of the total composition, of ammonium halides in which the nitrogen atom is substituted by at least one alkyl group having at least 14 carbon atoms and more than 5%, preferably more than 7% in weight by weight of the total composition, of ammonium halides in which the nitrogen atom is substituted by at least one alkyl group having at least 16 carbon atoms. Also, ophthalmic oil-in-water emulsions containing such compositions, the ophthalmic emulsions being useful for eye care or for the treatment of eye conditions.

Abstract: Compositions containing quaternary compounds in which the nitrogen atom is substituted by at least one alkyl group having at least 12 carbon atoms, and the composition includes at least 20% in weight by weight of the total composition, of ammonium halides in which the nitrogen atom is substituted by at least one alkyl group having at least 14 carbon atoms and more than 5%, preferably more than 7% in weight by weight of the total composition, of ammonium halides in which the nitrogen atom is substituted by at least one alkyl group having at least 16 carbon atoms. Also, ophthalmic oil-in-water emulsions containing such compositions, the ophthalmic emulsions being useful for eye care or for the treatment of eye conditions.

Abstract: The present invention relates to new processes for the preparation of oil-in-water emulsions useful in ophthalmic applications. In particular, processes are provided that include preparing a pre-concentrate of the oil-in-water emulsion, and diluting the pre-concentrate obtained to form the desired oil-in-water emulsion. The present invention also provides pharmaceutical compositions comprising an oil-in-water emulsion prepared by an inventive process, and methods of using these compositions for the treatment of an eye disease or condition.

Abstract: The present invention provides a method for providing antisense therapy which reduces the expression of clusterin to provide therapeutic benefit in the treatment of cancer, comprising administering an anti-clusterin oligonucleotide having the sequence CAGCAGCAGAGTCTTCATCAT (Seq. ID No.: 1), wherein the anti-clusterin oligonucleotide has a phosphorothioate backbone throughout, has sugar moieties of nucleotides 1-4 and 18-21 bearing 2?-O-methoxyethyl modifications, has nucleotides 5-17 which are 2?deoxynucleotides, and has 5-methylcytosines at nucleotides 1, 4, and 19, to a human subject in need of treatment for the cancer, which human subject also receives at least one chemotherapeutic agent, hormone ablation therapy, or radiation therapy, wherein the anti-clusterin oligonucleotide is administered at least 3 times during a 5 to 9 day period, wherein at least 1 of the administrations is at a dose other than 640 mg.

Abstract: Compositions containing quaternary compounds in which the nitrogen atom is substituted by at least one alkyl group having at least 12 carbon atoms, and the composition includes at least 20% in weight by weight of the total composition, of ammonium halides in which the nitrogen atom is substituted by at least one alkyl group having at least 14 carbon atoms and more than 5%, preferably more than 7% in weight by weight of the total composition, of ammonium halides in which the nitrogen atom is substituted by at least one alkyl group having at least 16 carbon atoms. Also, ophthalmic oil-in-water emulsions containing such compositions, the ophthalmic emulsions being useful for eye care or for the treatment of eye conditions.

Abstract: Compositions containing quaternary compounds in which the nitrogen atom is substituted by at least one alkyl group having at least 12 carbon atoms, and the composition includes at least 20% in weight by weight of the total composition, of ammonium halides in which the nitrogen atom is substituted by at least one alkyl group having at least 14 carbon atoms and more than 5%, preferably more than 7% in weight by weight of the total composition, of ammonium halides in which the nitrogen atom is substituted by at least one alkyl group having at least 16 carbon atoms. Also, ophthalmic oil-in-water emulsions containing such compositions, the ophthalmic emulsions being useful for eye care or for the treatment of eye conditions.

Abstract: Described is the use of prodrug for the manufacture of a medicament useful for treating an ocular disease affecting the posterior segment of the eye, in a subject in need thereof, wherein the prodrug is a composition injected into the vitreous body, and the frequency of injections does not exceed one injection per month.

Abstract: Compositions containing quaternary ammonium compounds in which the nitrogen atom is substituted by at least one alkyl group having at least 12 carbon atoms, where composition includes at least 20% in weight by weight of the total composition, of ammonium halides in which the nitrogen atom is substituted by at least one alkyl group having at least 14 carbon atoms and more than 5%, preferably more than 7% in weight by weight of the total composition, of ammonium halides in which the nitrogen atom is substituted by at least one alkyl group having at least 16 carbon atoms. Ophthalmic oil-in-water emulsions containing such compositions, and the ophthalmic emulsions being are useful for eye care or for the treatment of eye conditions.

Abstract: The present invention provides a method for providing antisense therapy which reduces the expression of clusterin to provide therapeutic benefit in the treatment of cancer, comprising administering an anti-clusterin oligonucleotide having the sequence CAGCAGCAGAGTCTTCATCAT (Seq. ID No.: 1), wherein the anti-clusterin oligonucleotide has a phosphorothioate backbone throughout, has sugar moieties of nucleotides 1-4 and 18-21 bearing 2?-O-methoxyethyl modifications, has nucleotides 5-17 which are 2? deoxynucleotides, and has 5-methylcytosines at nucleotides 1, 4, and 19, to a human subject in need of treatment for the cancer, which human subject also receives at least one chemotherapeutic agent, hormone ablation therapy, or radiation therapy, wherein the anti-clusterin oligonucleotide is administered at least 3 times during a 5 to 9 day period, wherein at least 1 of the administrations is at a dose other than 640 mg.

Abstract: Compositions containing quaternary compounds in which the nitrogen atom is substituted by at least one alkyl group having at least 12 carbon atoms, and the composition includes at least 20% in weight by weight of the total composition, of ammonium halides in which the nitrogen atom is substituted by at least one alkyl group having at least 14 carbon atoms and more than 5%, preferably more than 7% in weight by weight of the total composition, of ammonium halides in which the nitrogen atom is substituted by at least one alkyl group having at least 16 carbon atoms. Also, ophthalmic oil-in-water emulsions containing such compositions, the ophthalmic emulsions being useful for eye care or for the treatment of eye conditions.

Abstract: Oil-in-water emulsion including a non-steroidal anti-inflammatory drug and a quaternary ammonium halide useful for the prevention and treatment of inflammation in the eye, and process for manufacturing thereof.

Abstract: An ophthalmic oil-in-water type emulsion, which includes colloid particles having an oily core surrounded by an interfacial film, the emulsion including at least one cationic agent, at least one no ionic surfactant, the emulsion having a positive zeta potential and meeting zeta potential stability Test A requirements. Process for making the emulsions. Delivery device selected from the group including lenses, ocular patch, implant, insert, the device containing an emulsion according to the invention.

Abstract: Ophthalmic oil-in-water emulsions, which comprises colloid particles having an oily core surrounded by an interfacial film, the emulsion comprising an 10 immunosuppressive agent, an oil, preferably at least 50% of which being MCT, and tyloxapol. Use of such an emulsion for the manufacture of medicament for treatment of eye conditions, particularly of dry eye diseases.

Abstract: A well tolerated oil-in-water emulsion useful as a delivery vehicle of hydrophobic ingredients such as pharmaceutical drugs, wherein the emulsion particles have a net positive charge and comprises 0.001 to 0.1% of a cationic agent, 0 to 1% of a non ionic surfactant and 0 to 0.5% of an anionic surfactant.

Abstract: Cationic ophthalmic oil-in-water type emulsions, include colloid particles having an oily core surrounded by an interfacial film, the emulsion including at least one cationic agent and at least one non ionic surfactant, the oily core including a prostaglandin selected from the group comprising in particular latanoprost, unoprostone isopropyl, travoprost, bimatoprost, tafluprost, 8-isoprostaglandinE2, or a mixture thereof, for treating ocular hypertension and/or glaucoma. These emulsions have the property to increase the chemical stability of prostaglandins.