Patents by Inventor Laura Rabinovich-Guilatt

Laura Rabinovich-Guilatt has filed for patents to protect the following inventions. This listing includes patent applications that are pending as well as patents that have already been granted by the United States Patent and Trademark Office (USPTO).

  • Publication number: 20210038721
    Abstract: Compositions containing quaternary compounds in which the nitrogen atom is substituted by at least one alkyl group having at least 12 carbon atoms, and the composition includes at least 20% in weight by weight of the total composition, of ammonium halides in which the nitrogen atom is substituted by at least one alkyl group having at least 14 carbon atoms and more than 5%, preferably more than 7% in weight by weight of the total composition, of ammonium halides in which the nitrogen atom is substituted by at least one alkyl group having at least 16 carbon atoms. Also, ophthalmic oil-in-water emulsions containing such compositions, the ophthalmic emulsions being useful for eye care or for the treatment of eye conditions.
    Type: Application
    Filed: October 21, 2020
    Publication date: February 11, 2021
    Inventors: Laura RABINOVICH-GUILATT, Gregory LAMBERT, Frederic LALLEMAND, Betty PHILIPS
  • Patent number: 10842873
    Abstract: Compositions containing quaternary compounds in which the nitrogen atom is substituted by at least one alkyl group having at least 12 carbon atoms, and the composition includes at least 20% in weight by weight of the total composition, of ammonium halides in which the nitrogen atom is substituted by at least one alkyl group having at least 14 carbon atoms and more than 5%, preferably more than 7% in weight by weight of the total composition, of ammonium halides in which the nitrogen atom is substituted by at least one alkyl group having at least 16 carbon atoms. Also, ophthalmic oil-in-water emulsions containing such compositions, the ophthalmic emulsions being useful for eye care or for the treatment of eye conditions.
    Type: Grant
    Filed: April 5, 2018
    Date of Patent: November 24, 2020
    Assignee: SANTEN SAS
    Inventors: Laura Rabinovich-Guilatt, Gregory Lambert, Frederic Lallemand, Betty Philips
  • Publication number: 20200000924
    Abstract: Compositions containing quaternary compounds in which the nitrogen atom is substituted by at least one alkyl group having at least 12 carbon atoms, and the composition includes at least 20% in weight by weight of the total composition, of ammonium halides in which the nitrogen atom is substituted by at least one alkyl group having at least 14 carbon atoms and more than 5%, preferably more than 7% in weight by weight of the total composition, of ammonium halides in which the nitrogen atom is substituted by at least one alkyl group having at least 16 carbon atoms. Also, ophthalmic oil-in-water emulsions containing such compositions, the ophthalmic emulsions being useful for eye care or for the treatment of eye conditions.
    Type: Application
    Filed: April 5, 2018
    Publication date: January 2, 2020
    Inventors: Laura RABINOVICH-GUILATT, Gregory LAMBERT, Frederic LALLEMAND, Betty PHILIPS
  • Publication number: 20190022231
    Abstract: Compositions containing quaternary compounds in which the nitrogen atom is substituted by at least one alkyl group having at least 12 carbon atoms, and the composition includes at least 20% in weight by weight of the total composition, of ammonium halides in which the nitrogen atom is substituted by at least one alkyl group having at least 14 carbon atoms and more than 5%, preferably more than 7% in weight by weight of the total composition, of ammonium halides in which the nitrogen atom is substituted by at least one alkyl group having at least 16 carbon atoms. Also, ophthalmic oil-in-water emulsions containing such compositions, the ophthalmic emulsions being useful for eye care or for the treatment of eye conditions.
    Type: Application
    Filed: April 5, 2018
    Publication date: January 24, 2019
    Inventors: Laura RABINOVICH-GUILATT, Gregory LAMBERT, Frederic LALLEMAND, Betty PHILIPS
  • Patent number: 9956289
    Abstract: Compositions containing quaternary compounds in which the nitrogen atom is substituted by at least one alkyl group having at least 12 carbon atoms, and the composition includes at least 20% in weight by weight of the total composition, of ammonium halides in which the nitrogen atom is substituted by at least one alkyl group having at least 14 carbon atoms and more than 5%, preferably more than 7% in weight by weight of the total composition, of ammonium halides in which the nitrogen atom is substituted by at least one alkyl group having at least 16 carbon atoms. Also, ophthalmic oil-in-water emulsions containing such compositions, the ophthalmic emulsions being useful for eye care or for the treatment of eye conditions.
    Type: Grant
    Filed: November 17, 2015
    Date of Patent: May 1, 2018
    Assignee: SANTEN SAS
    Inventors: Laura Rabinovich-Guilatt, Gregory Lambert, Frederic Lallemand, Betty Philips
  • Patent number: 9364496
    Abstract: The present invention provides a method for providing antisense therapy which reduces the expression of clusterin to provide therapeutic benefit in the treatment of cancer, comprising administering an anti-clusterin oligonucleotide having the sequence CAGCAGCAGAGTCTTCATCAT (Seq. ID No.: 1), wherein the anti-clusterin oligonucleotide has a phosphorothioate backbone throughout, has sugar moieties of nucleotides 1-4 and 18-21 bearing 2?-O-methoxyethyl modifications, has nucleotides 5-17 which are 2?deoxynucleotides, and has 5-methylcytosines at nucleotides 1, 4, and 19, to a human subject in need of treatment for the cancer, which human subject also receives at least one chemotherapeutic agent, hormone ablation therapy, or radiation therapy, wherein the anti-clusterin oligonucleotide is administered at least 3 times during a 5 to 9 day period, wherein at least 1 of the administrations is at a dose other than 640 mg.
    Type: Grant
    Filed: March 12, 2014
    Date of Patent: June 14, 2016
    Assignee: ONCOGENEX TECHNOLOGIES INC.
    Inventors: Laura Rabinovich-Guilatt, Anna Elgart
  • Patent number: 9364461
    Abstract: The present invention relates to new processes for the preparation of oil-in-water emulsions useful in ophthalmic applications. In particular, processes are provided that include preparing a pre-concentrate of the oil-in-water emulsion, and diluting the pre-concentrate obtained to form the desired oil-in-water emulsion. The present invention also provides pharmaceutical compositions comprising an oil-in-water emulsion prepared by an inventive process, and methods of using these compositions for the treatment of an eye disease or condition.
    Type: Grant
    Filed: December 21, 2007
    Date of Patent: June 14, 2016
    Assignee: SANTEN SAS
    Inventors: Gregory Lambert, Frederic Lallemand, Laura Rabinovich-Guilatt, Pascal Candillon, Julien Lafosse
  • Publication number: 20160082107
    Abstract: Compositions containing quaternary compounds in which the nitrogen atom is substituted by at least one alkyl group having at least 12 carbon atoms, and the composition includes at least 20% in weight by weight of the total composition, of ammonium halides in which the nitrogen atom is substituted by at least one alkyl group having at least 14 carbon atoms and more than 5%, preferably more than 7% in weight by weight of the total composition, of ammonium halides in which the nitrogen atom is substituted by at least one alkyl group having at least 16 carbon atoms. Also, ophthalmic oil-in-water emulsions containing such compositions, the ophthalmic emulsions being useful for eye care or for the treatment of eye conditions.
    Type: Application
    Filed: November 17, 2015
    Publication date: March 24, 2016
    Inventors: Laura RABINOVICH-GUILATT, Gregory LAMBERT, Frederic LALLEMAND, Betty PHILIPS
  • Patent number: 9220694
    Abstract: Compositions containing quaternary compounds in which the nitrogen atom is substituted by at least one alkyl group having at least 12 carbon atoms, and the composition includes at least 20% in weight by weight of the total composition, of ammonium halides in which the nitrogen atom is substituted by at least one alkyl group having at least 14 carbon atoms and more than 5%, preferably more than 7% in weight by weight of the total composition, of ammonium halides in which the nitrogen atom is substituted by at least one alkyl group having at least 16 carbon atoms. Also, ophthalmic oil-in-water emulsions containing such compositions, the ophthalmic emulsions being useful for eye care or for the treatment of eye conditions.
    Type: Grant
    Filed: August 2, 2013
    Date of Patent: December 29, 2015
    Assignee: SANTEN SAS
    Inventors: Laura Rabinovich-Guilatt, Gregory Lambert, Frederic Lallemand, Betty Philips
  • Patent number: 9192567
    Abstract: Described is the use of prodrug for the manufacture of a medicament useful for treating an ocular disease affecting the posterior segment of the eye, in a subject in need thereof, wherein the prodrug is a composition injected into the vitreous body, and the frequency of injections does not exceed one injection per month.
    Type: Grant
    Filed: June 1, 2007
    Date of Patent: November 24, 2015
    Assignee: SANTEN SAS
    Inventors: Laura Rabinovich-Guilatt, Gregory Lambert
  • Patent number: 9132071
    Abstract: Compositions containing quaternary ammonium compounds in which the nitrogen atom is substituted by at least one alkyl group having at least 12 carbon atoms, where composition includes at least 20% in weight by weight of the total composition, of ammonium halides in which the nitrogen atom is substituted by at least one alkyl group having at least 14 carbon atoms and more than 5%, preferably more than 7% in weight by weight of the total composition, of ammonium halides in which the nitrogen atom is substituted by at least one alkyl group having at least 16 carbon atoms. Ophthalmic oil-in-water emulsions containing such compositions, and the ophthalmic emulsions being are useful for eye care or for the treatment of eye conditions.
    Type: Grant
    Filed: January 30, 2008
    Date of Patent: September 15, 2015
    Assignee: SANTEN SAS
    Inventors: Laura Rabinovich-Guilatt, Gregory Lambert, Frederic Lallemand, Betty Philips
  • Publication number: 20140275214
    Abstract: The present invention provides a method for providing antisense therapy which reduces the expression of clusterin to provide therapeutic benefit in the treatment of cancer, comprising administering an anti-clusterin oligonucleotide having the sequence CAGCAGCAGAGTCTTCATCAT (Seq. ID No.: 1), wherein the anti-clusterin oligonucleotide has a phosphorothioate backbone throughout, has sugar moieties of nucleotides 1-4 and 18-21 bearing 2?-O-methoxyethyl modifications, has nucleotides 5-17 which are 2? deoxynucleotides, and has 5-methylcytosines at nucleotides 1, 4, and 19, to a human subject in need of treatment for the cancer, which human subject also receives at least one chemotherapeutic agent, hormone ablation therapy, or radiation therapy, wherein the anti-clusterin oligonucleotide is administered at least 3 times during a 5 to 9 day period, wherein at least 1 of the administrations is at a dose other than 640 mg.
    Type: Application
    Filed: March 12, 2014
    Publication date: September 18, 2014
    Applicant: TEVA PHARMACEUTICAL INDUSTRIES, LTD.
    Inventors: Laura Rabinovich-Guilatt, Anna Elgart
  • Publication number: 20130337019
    Abstract: Compositions containing quaternary compounds in which the nitrogen atom is substituted by at least one alkyl group having at least 12 carbon atoms, and the composition includes at least 20% in weight by weight of the total composition, of ammonium halides in which the nitrogen atom is substituted by at least one alkyl group having at least 14 carbon atoms and more than 5%, preferably more than 7% in weight by weight of the total composition, of ammonium halides in which the nitrogen atom is substituted by at least one alkyl group having at least 16 carbon atoms. Also, ophthalmic oil-in-water emulsions containing such compositions, the ophthalmic emulsions being useful for eye care or for the treatment of eye conditions.
    Type: Application
    Filed: August 2, 2013
    Publication date: December 19, 2013
    Applicant: NOVAGALI PHARMA SA
    Inventors: LAURA RABINOVICH-GUILATT, GREGORY LAMBERT, FREDERIC LALLEMAND, BETTY PHILIPS
  • Patent number: 8512687
    Abstract: Oil-in-water emulsion including a non-steroidal anti-inflammatory drug and a quaternary ammonium halide useful for the prevention and treatment of inflammation in the eye, and process for manufacturing thereof.
    Type: Grant
    Filed: July 29, 2010
    Date of Patent: August 20, 2013
    Assignee: Novagali Pharma SA
    Inventors: Grégory Lambert, Laura Rabinovich-Guilatt, Frédéric Lallemand, Jean-Sébastien Garrigue, Betty Philips
  • Patent number: 8372434
    Abstract: An ophthalmic oil-in-water type emulsion, which includes colloid particles having an oily core surrounded by an interfacial film, the emulsion including at least one cationic agent, at least one no ionic surfactant, the emulsion having a positive zeta potential and meeting zeta potential stability Test A requirements. Process for making the emulsions. Delivery device selected from the group including lenses, ocular patch, implant, insert, the device containing an emulsion according to the invention.
    Type: Grant
    Filed: October 10, 2005
    Date of Patent: February 12, 2013
    Assignee: Novagali Pharma SA
    Inventors: Séverine Bague, Betty Philips, Laura Rabinovich-Guilatt, Gregory Lambert, Jean-Sébastien Garrigue
  • Patent number: 8298569
    Abstract: Ophthalmic oil-in-water emulsions, which comprises colloid particles having an oily core surrounded by an interfacial film, the emulsion comprising an 10 immunosuppressive agent, an oil, preferably at least 50% of which being MCT, and tyloxapol. Use of such an emulsion for the manufacture of medicament for treatment of eye conditions, particularly of dry eye diseases.
    Type: Grant
    Filed: October 10, 2005
    Date of Patent: October 30, 2012
    Assignee: Novagali Pharma SA
    Inventors: Betty Philips, Severine Bague, Laura Rabinovich-Guilatt, Gregory Lambert
  • Patent number: 8298568
    Abstract: A well tolerated oil-in-water emulsion useful as a delivery vehicle of hydrophobic ingredients such as pharmaceutical drugs, wherein the emulsion particles have a net positive charge and comprises 0.001 to 0.1% of a cationic agent, 0 to 1% of a non ionic surfactant and 0 to 0.5% of an anionic surfactant.
    Type: Grant
    Filed: November 18, 2004
    Date of Patent: October 30, 2012
    Assignee: Novagali Pharma SA
    Inventors: Séverine Bague, Betty Philips, Jean-Sébastien Garrigue, Laura Rabinovich-Guilatt, Gregory Lambert
  • Patent number: 8273362
    Abstract: Cationic ophthalmic oil-in-water type emulsions, include colloid particles having an oily core surrounded by an interfacial film, the emulsion including at least one cationic agent and at least one non ionic surfactant, the oily core including a prostaglandin selected from the group comprising in particular latanoprost, unoprostone isopropyl, travoprost, bimatoprost, tafluprost, 8-isoprostaglandinE2, or a mixture thereof, for treating ocular hypertension and/or glaucoma. These emulsions have the property to increase the chemical stability of prostaglandins.
    Type: Grant
    Filed: October 10, 2005
    Date of Patent: September 25, 2012
    Assignee: Novagali Pharma S.A.
    Inventors: Betty Philips, Séverine Bague, Laura Rabinovich-Guilatt, Grégory Lambert
  • Patent number: 8227452
    Abstract: Use of a composition comprising at least one prodrug of a steroid, preferably of a corticosteroid, for the preparation of an ophthalmic composition intended for the treatment of an ocular condition or disease of a human being or an animal.
    Type: Grant
    Filed: June 1, 2007
    Date of Patent: July 24, 2012
    Assignee: Novagali Pharma SA
    Inventors: Laura Rabinovich-Guilatt, Gregory Lambert
  • Patent number: 8071114
    Abstract: This invention relates to compositions containing quaternary ammonium compounds in which the nitrogen atom is substituted by at least one alkyl group having at least 12 carbon atoms, characterized in that said composition includes at least 20% in weight by weight of the total composition, of ammonium halides in which the nitrogen atom is substituted by at least one alkyl group having at least 14 carbon atoms and more than 5%, preferably more than 7% in weight by weight of the total composition, of ammonium halides in which the nitrogen atom is substituted by at least one alkyl group having at least 16 carbon atoms. This invention also relates to ophthalmic oil-in-water emulsions containing such compositions, said ophthalmic emulsions being useful for eye care or for the treatment of eye conditions.
    Type: Grant
    Filed: July 9, 2007
    Date of Patent: December 6, 2011
    Assignee: Novagli Pharma S.A.
    Inventors: Laura Rabinovich-Guilatt, Gregory Lambert, Frederic Lallemand, Betty Philips