Abstract: An interactive scenario implementation method includes: displaying, on a game scenario structure interface, one or more readable game scenario blocks. Each block represents one or more game scenarios that a player has played, and each block has a corresponding game scenario path data stored. The method also includes: determining, according to a scenario skipping instruction triggered by the player through the game scenario structure interface, a skip-origin block and a skip-destination block; updating, upon determining that the skip-origin block is located on a target game scenario path and that skip-origin game scenario path data of the skip-origin block and target game scenario path data of the skip-destination block have connectivity in the game logic, the target game scenario path data according to the skip-origin game scenario path data. A game scenario corresponding to the skip-destination block is entered according to the updated target game scenario path data.

Abstract: The present invention relates to a piRNA-54265 detection kit used for early screening, diagnosis, efficacy monitoring and/or prognostic evaluation of colorectal cancer. The detection kit includes a primers combination, including a primer pair and a probe for specifically detecting piRNA-54265; the primer pair is a piRNA-54265 stem-loop PCR primer pair, or a piRNA-54265 PolyA tailed PCR primer pair; the primer pair includes a forward primer and a reverse primer.

Abstract: A deepwater subsea coiled tubing drilling rig includes a lifting rack having an upper rack and a lower rack which are sleeved with each other and connected by a lifting device. A working space is enclosed by the upper rack and the lower rack, and an underwater connecting and disconnecting tool is installed in the working space; the working space is transformed between a high-position large-space state for connecting and disconnecting through the tool and a low-position small-space state for the drilling process, along with the up-down movement of the upper rack. The upper rack is provided with an underwater coiled tubing system used for lowering and lifting a downhole tool combination, and the lower rack is provided with a wellhead device.

Abstract: The present invention relates to a piRNA-54265 detection kit used for early screening, diagnosis, efficacy monitoring and/or prognostic evaluation of colorectal cancer. The detection kit includes a primers combination, including a primer pair and a probe for specifically detecting piRNA-54265; the primer pair is a piRNA-54265 stem-loop PCR primer pair, or a piRNA-54265 PolyA tailed PCR primer pair; the primer pair includes a forward primer and a reverse primer.

Abstract: An electric drilling tool suitable for ocean under rater drilling rig is provided, which belongs to the technical field of ocean drilling equipment and includes a power supply assembly, a motor assembly and a bit assembly. The power supply assembly includes a power distribution cabinet, a power supply cable and a cable plug. The motor assembly includes a connecting joint, an upper machine head, a motor housing, a stator assembly, a rotor assembly, a centering bearing, stabilizing bearings, a rotating shaft, a lower machine head and a protector. The bit assembly includes a transition joint and a bit.

Abstract: An electric drilling tool suitable for ocean under rater drilling rig is provided, which belongs to the technical field of ocean drilling equipment and includes a power supply assembly, a motor assembly and a bit assembly. The power supply assembly includes a power distribution cabinet, a power supply cable and a cable plug. The motor assembly includes a connecting joint, an upper machine head, a motor housing, a stator assembly, a rotor assembly, a centering bearing, stabilizing bearings, a rotating shaft, a lower machine head and a protector. The bit assembly includes a transition joint and a bit.

Abstract: An interactive scenario implementation method includes: displaying, on a game scenario structure interface, one or more readable game scenario blocks, each block representing one or more game scenarios that a player has played, and each block having a corresponding game scenario path data stored; receiving a scenario skipping instruction triggered by the player through the game scenario structure interface; determining, according to the scenario skipping instruction, a skip-origin block and a skip-destination block; updating, upon determining that the skip-origin block is located on a target game scenario path and determining that skip-origin game scenario path data of the skip-origin block and target game scenario path data of the skip-destination block have connectivity in game logic, the target game scenario path data according to the skip-origin game scenario path data; and entering a game scenario corresponding to the skip-destination block according to the updated target game scenario path data.

Abstract: The present invention relates to a marker piRNA-54265 and a method in diagnosis, treatment, and prognostic evaluation of colorectal cancer. The marker piRNA-54265 is capable of being used for diagnosing and/or treating colorectal cancer, wherein the marker piRNA-54265 is selected from any of molecules as follows: (1) SEQ ID NO.29: tggaggtgatgaactgtctgagcctgacc; (2) SEQ ID NO.30: UGGAGGUGAUGAACUGUCUGAGCCUGACC; (3) SEQ ID NO.31: GGUCAGGCUCAGACAGUUCAUCACCUCCA; (4) a piR-54265 variant and a piR-54265 derivative modified from the molecule shown in (1), (2) or (3) with a same function; (5) a piR-54265 polynucleotide construct capable of down-regulating an amount of the piR-54265 in vivo after being introduced; and (6) an expression vector containing the polynucleotide construct of (5). The method is used for diagnosing/screening colorectal cancer, evaluating chemosensitivity of a colorectal cancer patient, evaluating a prognosis of a colorectal cancer patient or treating colorectal cancer.