Abstract: Three important species of Aspergillus, A. fumigatus, A. flavus and A. niger are known to contribute to the pathogenicity of allergic and invasive diseases in humans. They are also known to be plant pathogens. Several important ESTs/genes of Aspergilli species are now identified and characterized. Efforts are still needed to explore 30% genes of Aspergillus species for their valuable products which need to be explored. Polyketide biosynthetic pathway in Aspergillus species produce important secondary metabolites like polyketide toxins such as Aflatoxins, drugs such as Lovastatins and several other important pharmaceutically important polyketide compounds etc. With the availability of Aspergillus genome sequences it is possible today to characterize the structure and function of important genes of Aspergillus species. Based on the gene sequence information on PKS enzymes in medically and agriculturally important Aspergillus species such as A. fumigatus, A. flavus and A.

Abstract: Three important species of Aspergillus, A. fumigatus, A. flavus and A. niger are known to contribute to the pathogenicity of allergic and invasive diseases in humans. They are also known to be plant pathogens. Several important ESTs/genes of Aspergilli species are now identified and characterized. Efforts are still needed to explore 30% genes of Aspergillus species for their valuable products which need to be explored. Polyketide biosynthetic pathway in Aspergillus species produce important secondary metabolites like polyketide toxins such as Aflatoxins, drugs such as Lovastatins and several other important pharmaceutically important polyketide compounds etc. With the availability of Aspergillus genome sequences it is possible today to characterize the structure and function of important genes of Aspergillus species. Based on the gene sequence information on PKS enzymes in medically and agriculturally important Aspergillus species such as A. fumigatus, A. flavus and A.

Abstract: The present invention provides a pharmaceutical composition comprising purified human mannan-binding lectin (MBL) optionally along with carriers administered at a unit dose in the range of 1.0 ?g-5.0 ?g/20 kg body weight. Further, it also deals with a method and use thereof for the treatment of invasive pulmonary aspergillosis using said composition.

Abstract: The invention provides a simple method for isolation of calliterpenone (16?,17 dihydroxy-3-oxo phyllocladane), a phyllocladane diterpenoid with the plant growth regulating properties, from plant genus Callicarpa.

Abstract: The present invention provides an improved process for the isolation of oleane compounds from the bark of Terminallia arjuna (Roxb.). More particularly, the present invention relates to an improved process for the isolation of arjunic acid and its derivates from the bark of Terminallia arjuna (Roxb.). The present invention further provides the identification of arjunic acid [1] and its derivatives as anticancer agent useful in the treatment of various types of cancer in humans.

Abstract: The present invention is related to the development of a novel, distinct high herb and artemisinin yielding genotype of Artemisia annua obtained through systematic marker assisted breeding followed by selection of uniform population in a methodical way wherein the genotype is distinct, uniform and stably maintainable by continuous rouging of off types in the population using DNA marker at early seedling stage from nursery itself and suitable for commercial cultivation.

Abstract: The present invention is related to the development of a novel, distinct high herb and artemisinin yielding genotype of Artemisia annua obtained through systematic marker assisted breeding followed by selection of uniform population in a methodical way wherein the genotype is distinct, uniform and stably maintainable by continuous rouging of off types in the population using DNA marker at early seedling stage from nursery itself and suitable for commercial cultivation.

Abstract: The present invention relates to a pair of primers with forward primer of SEQ ID NO. 1 having sequence of CCAAGCTTGCTGAACGCATCGG, and reverse primer of SEQ ID No. 2 having sequence of CCAAGCTTGCCACGCAGGATTATC, and a screening method for early identification of plants Artemisia annua having high content of artemisinin and thereby helping generation of plant population with further high content of artemisinin.

Abstract: The invention relates to a novel pharmaceutical composition comprising an effective amount of bio-active fraction from cow urine distillate as a bioavailability facilitator and pharmaceutically acceptable additives selected from anticancer compounds, antibiotics, drugs, therapeutic and nutraceutic agents, ions and similar molecules which are targeted to the living systems.

Abstract: The present invention relates to a cultivar of Phyllanthus amarus ‘CIM-Jeevan’, producing high amount of herb, phyllanthin and hypophyllanthin, wherein said cultivar is developed through y-irradiation of superior gemplasm, the said plant produces high amount of herbage yield ranging between 1.0-1.15 kg per sqm fresh total plant herb, possesses high vegetative erect growth with a height ranging between 60 to 65 cm, produces phyllanthin ranging between 0.70-0.77% in dry herb, produces hypophyllanthin ranging between 0.32-0.37% in dry herb, and shows seed germination of about 90%.