Abstract: The present invention generally relates to a process for preparing polymeric-based nanoparticle of RPD coated with Tf and RVG comprises dissolving 1-12 wt % of RPD and 8-96 wt % of lipid in isopropyl alcohol (IPA) and heating the solution to 70° C. to create the organic phase; adding prepared organic solution to the 0-2 wt % of aqueous surfactant solution using a syringe at 70° C. temperature; swirling the obtained solution at 1000 rpm on a high speed homogenizer for 15 minutes after the solvent is evaporated using a magnetic stirrer to create the SLNs dispersion; and adding 45-100 wt % of Ethyl-3-(3-dimethylaminopropyl)carbodiimide (EDC) and 45-100 wt % of N-Hydroxysulfosuccinimide (NHS), which included activating the carboxylic acid terminal groups and conjugating Tf and RVG to RPD's PLGA nanoparticles.

Abstract: The present invention relates to bioactive extracts its fractions and isolation of compound from Rauwolfia tetraphylla. The extracts and fractions are useful for the treatment of psychosis based on in-vivo validation on animal model and proportional binding affinities for dopaminergic-D2, Cholinergic (muscarinic) and Serotonergic (5HT2A) receptors for antipsychotic activity. The present invention relates to novel antipsychotic activity in the leaf alkaloids of Formula 1 and 2 named tetrahydroalstonine, 10-methoxytetrahydroalstonine, isoreserpiline, 10-demethoxyreserpiline, 11-demethoxyreserpiline, reserpiline and ?-yohimbine. The present invention also relates to processes for obtaining antipsychotic extracts as well as for the isolation of alkaloids of formula 1 and 2 from the leaves of Rauwolfia tetraphylla. The present invention particularly relates to significant antipsychotic activity in the MeOH extract, ethylacetate and chloroform fractions of R.

Abstract: The present invention relates to bioactive extracts its fractions and isolation of compound from Rauwolfia tetraphylla. The extracts and fractions are useful for the treatment of psychosis based on in-vivo validation on animal model and proportional binding affinities for dopaminergic-D2, Cholinergic (muscarinic) and Serotonergic (5HT2A) receptors for antipsychotic activity. The present invention relates to novel antipsychotic activity in the leaf alkaloids of Formula 1 and 2 named tetrahydroalstonine, 10-methoxytetrahydroalstonine, isoreserpiline, 10-der?ethoxyreserpiline, 11-demethoxyreserpiline, reserpiline and ?-yohimbine. The present invention also relates to processes for obtaining antipsychotic extracts as well as for the isolation of alkabids of formula 1 and 2 from the leaves of Rauwolfia tetraphylla. The present invention particularly relates to significant antipsychotic activity in the MeOH extract, ethylacetate and chloroform fractions of R.

Abstract: The invention provides a simple method for isolation of calliterpenone (16?,17 dihydroxy-3-oxo phyllocladane), a phyllocladane diterpenoid with the plant growth regulating properties, from plant genus Callicarpa.

Abstract: The present invention relates to a pair of primers with forward primer of SEQ ID NO. 1 having sequence of CCAAGCTTGCTGAACGCATCGG, and reverse primer of SEQ ID No. 2 having sequence of CCAAGCTTGCCACGCAGGATTATC, and a screening method for early identification of plants Artemisia annua having high content of artemisinin and thereby helping generation of plant population with further high content of artemisinin.

Abstract: The present invention relates to a cultivar of Phyllanthus amarus ‘CIM-Jeevan’, producing high amount of herb, phyllanthin and hypophyllanthin, wherein said cultivar is developed through ?-irradiation of superior germplasm, the said plant produces high amount of herbage yield ranging between 1.0-1.15 kg per sqm fresh total plant herb, possesses high vegetative erect growth with a height ranging between 60 to 65 cm, produces phyllanthin ranging between 0.70-0.77% in dry herb, produces hypophyllanthin ranging between 0.32-0.37% in dry herb, and shows seed germination of about 90%.

Abstract: The present invention provides an improved process for the isolation of oleane compounds from the bark of Terminalia arjuna (Roxb.). More particularly, the present invention relates to an improved process for the isolation of arjunic acid and its derivates from the bark of Terminalia arjuna (Roxb.). The present invention further provides the identification of arjunic acid [1] and its derivatives as anticancer agent useful in the treatment of various types of cancer in humans.

Abstract: The present invention is related to the development of a novel, distinct high herb and artemisinin yielding genotype of Artemisia annua obtained through systematic marker assisted breeding followed by selection of uniform population in a methodical way wherein the genotype is distinct, uniform and stably maintainable by continuous rouging of off types in the population using DNA marker at early seedling stage from nursery itself and suitable for commercial cultivation.

Abstract: The invention relates to a novel pharmaceutical composition comprising an effective amount of bio-active fraction from cow urine distillate as a bioavailability facilitator and pharmaceutically acceptable additives selected from anticancer compounds, antibiotics, drugs, therapeutic and nutraceutic agents, ions and similar molecules which are targeted to the living systems.

Abstract: The invention relates to a novel pharmaceutical composition comprising an effective amount of bio-active fraction from cow urine distillate as a bioavailability facilitator and pharmaceutically acceptable additives selected from anticancer compounds, antibiotics, drugs, therapeutic and nutraceutic agents, ions and similar molecules which are targeted to the living systems.

Abstract: The present invention relates to a novel nitrile glycoside of Formula I named NIAZIRIDIN and to analogues and derivatives thereof. The present invention also relates to a process for the isolation of a novel nitrile glycoside of Formula I below named NIAZIRIDIN and its derivatives and analogues by bioactivity-guided fractionation from the pods of Moringa oleifera. The present invention particularly relates to the bioenhancing activity of the novel nitrile glycoside of Formula I below named NIAZIRIDIN and its derivatives and analogues in enhancing bioactivity of commonly used antibiotics such as rifampicin, tetracycline and ampicillin against Gram (+) and (?) bacteria. The biomolecule also enhances the absorption of drugs, vitamins and nutrients through the gastro-intestinal membrane increasing their bio-availability. Therefore niaziridin can be used in combination therapy with drugs and nutrients resulting in reduced drug associated toxicity, reduced cost and duration of chemotherapy.

Abstract: The present invention provides a novel process for the preparation of bacosides enriched fraction in a non-hygroscopic form the extract of Bacopa monniera, the said process comprising the steps of drying freshly harvested herb in a hot air oven at 37-42° C.

Abstract: The present invention relates to a novel nitrile glycoside of Formula I named NIAZIRIDIN and to analogues and derivatives thereof. The present invention also relates to a process for the isolation of a novel nitrile glycoside of Formula I below named NIAZIRIDIN and its derivatives and analogues by bioactivity-guided fractionation from the pods of Moringa oleifera. The present invention particularly relates to the bioenhancing activity of the novel nitrile glycoside of Formula I below named NIAZIRIDIN and its derivatives and analogues in enhancing bioactivity of commonly used antibiotics such as rifampicin, tetracycline and ampicillin against Gram (+) and (−) bacteria. The biomolecule also enhances the absorption of drugs, vitamins and nutrients through the gastro-intestinal membrane increasing their bio-availability. Therefore niaziridin can be used in combination therapy with drugs and nutrients resulting in reduced drug associated toxicity, reduced cost and duration of chemotherapy.

Abstract: The present invention relates to a process for the isolation of artemisinin, an antimalarial agent from the herb of the Artemisia annua plant, comprising of extracting the herb with ethanol, partitioning of the extract between water and hexane, followed by evaporative crystallization of artemisinin from hexane phase to produce substantially pure artemisinin.

Abstract: The present invention relates a hexane bioactive fraction and obtained from the roots of an aromatic plant named Vetiveria zizanioides commonly found in India for inhibiting the growth of drug resistant bacterial infections in humans and animals; also relates to a pharmaceutical composition comprising the bioactive extract with other additives for inhibiting the growth of drug resistant bacterial infections in humans and animals and a process for the isolation of said bioactive extract

Abstract: The present invention relates a hexane bioactive fraction and obtained from the roots of an aromatic plant named Vetiveria zizanioides commonly found in India for inhibiting the growth of drug resistant bacterial infections in humans and animals; also relates to a pharmaceutical composition comprising the bioactive extract with other additives for inhibiting the growth of drug resistant bacterial infections in humans and animals and a process for the isolation of said bioactive extract

Abstract: The present invention relates to a process for the isolation of artemisinin, an antimalarial agent from the herb of the Artemisia annua plant, comprising of extracting the herb with ethanol, partitioning of the extract between water and hexane, followed by evaporative crystallization of artemisinin from hexane phase to produce substantially pure artemisinin.

Abstract: The invention relates to the development of a new and distinct mutant ‘Dhawal’ of periwinkle, Catharanthus roseus, produced by chemical mutagen treatment of the seeds followed by rigorous selection in a widely cultivated variety ‘Nirmal’ of Catharanthus roseus, said plant being stable, homozygous and produces conspicuously higher herbage and alkaloid yield.

Abstract: The invention relates to a disease resistant and high yielding variety of opium poppy plant (Papaver somniferum L. 2n=22) christened as ‘Rakshit’.

Abstract: The invention relates to a novel pharmaceutical composition comprising an effective amount of bio-active fraction from cow urine distillate as a bioavailability facilitator and pharmaceutically acceptable additives selected from anticancer compounds, antibiotics, drugs, therapeutic and nutraceutic agents, ions and similar molecules which are targeted to the living systems.