Abstract: Treatments and methods for inhibiting late Na current use fibroblast growth factor homologous factor (FHF), an endogenous channel modulator, to inhibit late Na current with high potency. A minimal effector domain is engineered within FHF (the “FHF-inhibiting-X-region” (FixR)) as a peptide inhibitor of late Na current that may be delivered intracellularly, for example as a cell-penetrating peptide, or via viral or plasmid delivery. As a non-limiting example, human adenovirus type 5 may be genetically modified with the sequence 5?-ATGGCTGCGGCGATAGCCAGCTCCTTGATCCGGCAGAAGCGGCAGGCGAGGGAG TCCAACAGCGACCGAGTGTCGGCCTCCAAGCGCCGCTCCAGCCCCAGCAAAGAC GGGCGCTCC-3? (SEQ ID NO: 1).

Abstract: The method for increasing contractility in patients with systolic heart failure involves screening for candidate small molecules which block the interaction between Rad and the plasma membrane and/or block the interaction between Rad and the CaV1.2/CaV?2 complex, or between Rad and CaV?2, in order to increase cardiac contractility. A method for preventing calcium overload and arrhythmias in heart disease involves preventing the dissociation of Rad and the CaV1.2/CaV?2 complex, or between Rad and CaV?2, during beta-adrenergic system activation. Additionally, a method of screening for drugs that block interaction between an RGK GTPase protein and a ?-subunit of the calcium channel is provided. A suitable technique, such as fluorescence resonance energy transfer (FRET), may be used to assess blocking of the interaction between the RGK GTPase protein and the ?-subunit of the calcium channel for the treatment of heart disease, pain, diabetes, skeletal muscle disorders and/or central nervous system (CNS) disorders.