Patents by Inventor Marek Svoboda

Marek Svoboda has filed for patents to protect the following inventions. This listing includes patent applications that are pending as well as patents that have already been granted by the United States Patent and Trademark Office (USPTO).

  • METHOD OF DIAGNOSIS OF COLORECTAL CANCER
    Publication number: 20210130904
    Abstract: Method of diagnosing and prognosing colorectal cancer using piRNA-hsa-5937, having the sequence TCCCTGGTGGTCTAGTGGTTAGGATTCGGCA (SEQ ID NO. 1), as a biomarker, in combination with at least one miRNA selected from: (SEQ?ID?NO.?3) miR-23a-3p,?having?the?sequence AUCACAUUGCCAGGGAUUUCC, (SEQ?ID?NO.?4) miR-27a-3p,?having?the?sequence UUCACAGUGGCUAAGUUCCGC, (SEQ?ID?NO.?5) miR-142-5p,?having?the?sequence CAUAAAGUAGAAAGCACUACU. The resulting method uses a body fluid as the input, is non-invasive, has a high sensitivity and specificity even in very early stages of the disease, and is cost-effective.
    Type: Application
    Filed: July 13, 2018
    Publication date: May 6, 2021
    Applicants: MASARYKOVA UNIVERZITA, MASARYKUV ONKOLOGICKY USTAV
    Inventors: Ondrej SLABY, Petra VYCHYTILOVA, Marek SVOBODA, Milana SACHLOVA
  • Method for determining the sensitivity of patients suffering from a cancer disease to biological therapy
    Patent number: 8465936
    Abstract: The invention relates to a method for determining the sensitivity of patients suffering from a cancer disease towards targeted biological therapy based on the inhibition of signaling pathways of the members of HER family (e.g., HER-1, HER-2, HER-3 and HER-4) by determining the expression of the biomarker S6 kinase or its post-translationally modified form or of the biomarkers of the activation of S6 kinase or their post-translationally modified forms in the tumor.
    Type: Grant
    Filed: January 23, 2009
    Date of Patent: June 18, 2013
    Assignees: Univerzita Palackeho V Olomouci, Lekarska Fakulta, Masarykuv Onkologicky Ustav
    Inventors: Marian Hajduch, Marta Dziechciarkova, Lenka Radova, Marek Svoboda
  • Method For Determining The Sensitivity Of Patients Suffering From A Cancer Disease To Biological Therapy
    Publication number: 20110014637
    Abstract: The invention relates to a method for determining the sensitivity of patients suffering from a cancer disease towards targeted biological therapy based on the inhibition of signaling pathways of the members of HER family (e.g., HER-1, HER-2, HER-3 and HER-4) by determining the expression of the biomarker S6 kinase or its post-translationally modified form or of the biomarkers of the activation of S6 kinase or their post-translationally modified forms in the tumor.
    Type: Application
    Filed: January 23, 2009
    Publication date: January 20, 2011
    Inventors: Marian Hajduch, Marta Dziechciarkova, Lenka Radova, Marek Svoboda