Abstract: It has now been determined that antisense therapy which reduces the expression of TRPM-2 provides therapeutic benefits in the treatment of cancer. In particular, such antisense therapy can be applied in treatment of prostate cancer and renal cell cancer. Addition of antisense TRPM-2 ODN to prostatic tumor cells in vivo is effective for delaying the onset of androgen independence. Thus, prostate cancer can be treated in an individual suffering from prostate cancer by initiating androgen-withdrawal to induce apoptotic cell death of prostatic tumor cells in the individual, and administering to the individual a composition effective to inhibit expression of TRPM-2 by the tumor cells, thereby delaying the progression of prostatic tumor cells to an androgen-independent state in an individual Combined use of antisense TRPM-2 and taxanes synergistically enhances cytotoxic chemosensitivity of androgen-independent prostate cancer.

Abstract: RNAi sequences that are useful as therapeutics in the treatment of cancers of various types, including prostate cancer, sarcomas such as osteosarcoma, renal cell carcinoma, breast cancer, bladder cancer, lung cancer, colon cancer, ovarian cancer, anaplastic large cell lymphoma and melanoma; and Alzheimer's disease. These sequences target clusterin, IGFBP-5, IGFBP-2, both IGFBP-2 and -5 simultaneously, Mitf, and B-raf. The invention further provides for the use of these RNAi sequences in the treatment of cancers of various types, including prostate cancer, sarcomas such as osteosarcoma, renal cell carcinoma, breast cancer, bladder cancer, lung cancer, colon cancer, ovarian cancer, anaplastic large cell lymphoma and melanoma; and Alzheimer's disease, and a method of treating such conditions through the administration of the RNA molecules with RNAi activity to an individual, including a human individual in need of such treatment.

Abstract: RNAi sequences that are useful as therapeutics in the treatment of cancers of various types, including prostate cancer, sarcomas such as osteosarcoma, renal cell carcinoma, breast cancer, bladder cancer, lung cancer, colon cancer, ovarian cancer, anaplastic large cell lymphoma and melanoma; and Alzheimer's disease. These sequences target clusterin, IGFBP-5, IGFBP-2, both IGFBP-2 and -5 simultaneously, Mitf, and B-raf. The invention further provides for the use of these RNAi sequences in the treatment of cancers of various types, including prostate cancer, sarcomas such as osteosarcoma, renal cell carcinoma, breast cancer, bladder cancer, lung cancer, colon cancer, ovarian cancer, anaplastic large cell lymphoma and melanoma; and Alzheimer's disease, and a method of treating such conditions through the administration of the RNA molecules with RNAi activity to an individual, including a human individual in need of such treatment.

Abstract: Bispecific antisense oligonucleotides which consist essentially of a sequence of bases that is complementary to portions of both the gene encoding human IGFBP-2 and the gene encoding human IGFBP-5 are useful in as antisense therapeutics in the treatment of endocrine-regulated cancers.

Abstract: Antisense therapy which reduces the expression of TRPM-2 provides therapeutic benefits in the treatment of cancer. Seq ID No. 4 (cagcagcagagtcttcatcat) is an antisense oligonucleotide which inhibits expression of TRPM-2 by tumor cells, and which can be combined with a pharmaceutically acceptable carrier suitable for human administration.

Abstract: A cancer is evaluated for selection of appropriate therapy by evaluating a sample of cancerous tissue to determine an expression of level of phosphatase and tensin homologue deleted from chromosome 10 (PTEN); and in the case where the expression level of functional PTEN is below a threshold level, identifying the cancer as susceptible to an active agent that inhibits the expression of heat shock protein 27 (hsp27). The evaluation may be included as part of a method of treatment, in which an hsp27 inhibitor is selected as a therapeutic agent when the PTEN level is below the threshold.

Abstract: Administration of antisense oligodeoxynucleotides (ODN) targeted against the testosterone-repressed prostate message-2 (TRPM-2) gene can reduce the amount of TRPM-2 in renal cell cancer (RCC) cells and other cancer cells, and as a result enhance chemosensitivity of these cells to chemotherapy agents and radiation. Thus, for example, the sensitivity of renal cell cancer cells to a chemotherapeutic agent can be increased by exposing renal cell cancer cells to a chemotherapeutic agent and an agent which reduces the amount of TRPM-2 in the renal cell cancer cells. This provides an improved method for treatment of renal cell cancer, which is generally resistant to treatment with known chemotherapy agents.

Abstract: It has now been determined that antisense therapy which reduces the expression of TRPM-2 provides therapeutic benefits in the treatment of cancer. In particular, such antisense therapy can be applied in treatment of prostate cancer and renal cell cancer. Addition of antisense TRPM-2 ODN to prostatic tumor cells in vivo is effective for delaying the onset of androgen independence. Thus, prostate cancer can be treated in an individual suffering from prostate cancer by initiating androgen-withdrawal to induce apoptotic cell death of prostatic tumor cells in the individual, and administering to the individual a composition effective to inhibit expression of TRPM-2 by the tumor cells, thereby delaying the progression of prostatic tumor cells to an androgen-independent state in an individual Combined use of antisense TRPM-2 and taxanes synergistically enhances cytotoxic chemosensitivity of androgen-independent prostate cancer.

Abstract: Administration of antisense oligodeoxynucleotides (ODN) targeted against the testosterone-repressed prostate message-2 (TRPM-2) gene can reduce the amount of TRPM-2 in renal cell cancer (RCC) cells and other cancer cells, and as a result enhance chemosensitivity of these cells to chemotherapy agents and radiation. Thus, for example, the sensitivity of renal cell cancer cells to a chemotherapeutic agent can be increased by exposing renal cell cancer cells to a chemotherapeutic agent and an agent which reduces the amount of TRPM-2 in the renal cell cancer cells. This provides an improved method for treatment of renal cell cancer, which is generally resistant to treatment with known chemotherapy agents.

Abstract: Therapeutic agents which target heat shock protein (hsp) 27 in vivo are used to provide treatment to individuals, particularly human individuals, suffering from prostate cancer and other cancers that overexpress hsp27. A therapeutic agent, for example an antisense oligonucleotide or RNAi nucleotide inhibitor with sequence specificity for hsp27 mRNA, for example human hsp27 mRNA, is administered to an individual suffering from prostate cancer or some other cancer expressing elevated levels of hsp 27 in a therapeutically effective amount. The therapeutic agent is suitably formulated into a pharmaceutical composition which includes a pharmaceutically acceptable carrier, and packaged in dosage unit form. A preferred dosage unit form is an injectable dosage unit form.

Abstract: Antisense therapy which reduces the expression of TRPM-2 provides therapeutic benefits in the treatment of cancer for example prostate cancer and renal cell cancer. Antisense TRPM-2 ODN treatment of prostatic tumor cells in vivo is effective for delaying the onset of androgen independence and can be used in combination with androgen-withdrawal to induce apoptotic cell death of prostatic tumor cells in the individual. Combined use of antisense TRPM-2 and taxanes synergistically enhances cytotoxic chemosensitivity of androgen-independent prostate cancer. Radiation sensitivity is also enhanced when cells expressing TRPM-2 are treated with antisense TRPM-2 ODN. Thus, the antisense TRPM-2 ODNs can be used to enhance hormone sensitivity, chemosensitivity and radiation sensitivity of a variety of cancer types in which expression of TRPM-2 has been observed.

Abstract: RNAi sequences that are useful as therapeutics in the treatment of cancers of various types, including prostate cancer, sarcomas such as osteosarcoma, renal cell carcinoma, breast cancer, bladder cancer, lung cancer, colon cancer, ovarian cancer, anaplastic large cell lymphoma and melanoma; and Alzheimer's disease. These sequences target clusterin, IGFBP-5, IGFBP-2, both IGFBP-2 and -5 simultaneously, Mitf, and B-raf. The invention further provides for the use of these RNAi sequences in the treatment of cancers of various types, including prostate cancer, sarcomas such as osteosarcoma, renal cell carcinoma, breast cancer, bladder cancer, lung cancer, colon cancer, ovarian cancer, anaplastic large cell lymphoma and melanoma; and Alzheimer's disease, and a method of treating such conditions through the administration of the RNA molecules with RNAi activity to an individual, including a human individual in need of such treatment.

Abstract: It has been determined that antisense therapy which reduces the expression of TRPM-2 provides therapeutic benefits in the treatment of cancer, particularly prostate and renal cell cancers. Addition of antisense TRPM-2 ODN to prostatic tumor cells in vivo is effective for delaying the onset of androgen independence, thus prostate cancer can be treated by initiating androgen-withdrawal to induce apoptotic cell death of prostatic tumor cells in an individual, and administering a composition effective to inhibit expression of TRPM-2 by the tumor cells. Combined use of antisense TRPM-2 and taxanes synergistically enhances cytotoxic chemosensitivity of androgen-independent prostate cancer and in human Renal cell cancer. Radiation sensitivity is also enhanced when cells expressing TRPM-2 are treated with antisense TRPM-2 ODN.

Abstract: It has now been determined that antisense therapy which reduces the expression of TRPM-2 provides therapeutic benefits in the treatment of cancer. In particular, such antisense therapy can be applied in treatment of prostate cancer and renal cell cancer. Addition of antisense TRPM-2 ODN to prostatic tumor cells in vivo is effective for delaying the onset of androgen independence. Thus, prostate cancer can be treated in an individual suffering from prostate cancer by initiating androgen-withdrawal to induce apoptotic cell death of prostatic tumor cells in the individual, and administering to the individual a composition effective to inhibit expression of TRPM-2 by the tumor cells, thereby delaying the progression of prostatic tumor cells to an androgen-independent state in an individual Combined use of antisense TRPM-2 and taxanes synergistically enhances cytotoxic chemosensitivity of androgen-independent prostate cancer.

Abstract: A method is provided for treating hormone-regulated tumors (for example, breast and prostatic tumors) in mammals, including humans, by administration of an antisense ODN which is complementary to a portion of the gene encoding IGFBP-5. Using the Shionogi tumor model in vitro and in vivo, the administration of such an ODN was shown to reduce proliferation of tumor cells, and also to delay the progression to androgen independence. Thus, treatment of prostate cancer in mammals, including humans, and delay of the progression of prostate tumors to androgen independence is accomplished by administering to the mammal a therapeutically effective amount of an antisense oligodeoxynucleotide which is complementary to a portion of the nucleic acid sequence encoding IGFBP-5 and which hybridizes with such a sequence to inhibit expression of IGFBP-5. Specific antisense ODN's which are suitable for use in the method are GACCACGCTGATCACCAT (Seq. ID. No.

Abstract: Agents that perturb the EGF signaling pathway and that are known to be useful in the treatment of cancer are found also to result in increased expression of the protein clusterin. Since clusterin can provide protection against apoptosis, this secondary effect detracts from the efficacy of the therapeutic agent. This is overcome using a combination of an agent that has known therapeutic efficacy against the cancer to be treated by perturbation of the EGF signaling pathway and that stimulates expression of clusterin as a secondary effect, and an oligonucleotide that is effective to reduce the amount of clusterin in cancer cells small molecule inhibitor of HER-2, an antisense oligonucleotide specific for HER-2, or a peptide agent capable of interfering with HER-2 protein. The oligonucleotide may be an antisense oligonucleotide or an RNAi oligonucleotide.

Abstract: A method is provided for treating hormone-regulated tumors (for example, breast and prostatic tumors) in mammals, including humans, by administration of an antisense ODN which is complementary to a portion of the gene encoding IGFBP-5. Using the Shionogi tumor model in vitro and in vivo, the administration of such an ODN was shown to reduce proliferation of tumor cells, and also to delay the progression to androgen independence. Thus, treatment of prostate cancer in mammals, including humans, and delay of the progression of prostate tumors to androgen independence is accomplished by administering to the mammal a therapeutically effective amount of an antisense oligodeoxynucleotide which is complementary to a portion of the nucleic acid sequence encoding IGFBP-5 and which hybridizes with such a sequence to inhibit expression of IGFBP-5. Specific antisense ODN's which are suitable for use in the method are GACCACGCTGATCACCAT (Seq. ID. No.

Abstract: Treatment of melanoma is achieved through reduction in the effective amount of clusterin in melanoma cells of in a mammalian subject, preferably a human. A therapeutic agent effective to reduce the effective amount of clusterin in the melanoma cells is administered to the subject. The therapeutic agent may be, for example, an antisense ODN or small inhibitory RNA (siRNA) compound targeted to clusterin. bcl-xL in a subject or cell line can also be regulated by administering to the subject or cell line an agent effective to modulate the amount of clusterin expression. In particular, in clusterin expressing cells, the expression of bcl-xL is down-regulated when the effective amount of clusterin is reduced. Such inhibition is significant because bcl-xL is known to act as an inhibitor of apoptosis.

Abstract: Compositions and a method are provided for the treatment of prostate and other endocrine tumors in mammals, including humans, by administration of an antisense oligodeoxynucleotide (ODN) which is complementary to a portion of the gene encoding IGFBP-2. Using the Shionogi tumor model in vitro and in vivo, the administration of such an ODN was shown to reduce proliferation of tumor cells, and also to delay the progression to androgen independence. Thus, treatment of prostate and other hormone-regulated cancer in mammals, including humans, and delay of the progression of prostate tumors to androgen independence is accomplished by administering to the mammal a therapeutically effective amount of an antisense oligodeoxynucleotide which is complementary to a portion of the nucleic acid sequence encoding IGFBP-2 and which reduces the amount of IGFBP-2 in the treated cells.

Abstract: Therapeutic agents which target heat shock protein (hsp) 27 in vivo are used to provide treatment to individuals, particularly human individuals, suffering from prostate cancer and other cancers that overexpress hsp27. A therapeutic agent, for example an antisense oligonucleotide or RNAi nucleotide inhibitor with sequence specificity for hsp27 mRNA, for example human hsp27 mRNA, is administered to an individual suffering from prostate cancer or some other cancer expressing elevated levels of hsp 27 in a therapeutically effective amount. The therapeutic agent is suitably formulated into a pharmaceutical composition which includes a pharmaceutically acceptable carrier, and packaged in dosage unit form. A preferred dosage unit form is an injectable dosage unit form.