Patents by Inventor Michael L. Shelanski

Michael L. Shelanski has filed for patents to protect the following inventions. This listing includes patent applications that are pending as well as patents that have already been granted by the United States Patent and Trademark Office (USPTO).

  • Peptide having hydrolase activity
    Patent number: 7947279
    Abstract: The invention is directed to methods for increasing learning and memory in a subject with a neuropathological condition, specifically a condition related to elevated beta-amyloid deposition, the method comprising administering to the subject an effective amount of a compound capable of increasing the activity of Uch-L1. The invention is also directed to screening methods for identifying compounds that enhance the activity of the proteasome system, Uch-L1, or both.
    Type: Grant
    Filed: June 29, 2006
    Date of Patent: May 24, 2011
    Assignee: The Trustees of Columbia University in the City of New York
    Inventors: Ottavio Arancio, Michael L. Shelanski, Bing Gong
  • Methods for Treating Mild Cognitive Impairment
    Publication number: 20090298864
    Abstract: The present invention relates to compounds, compositions, and methods useful for: (i) treating or preventing mild cognitive impairment, or (ii) delaying the progression from mild cognitive impairment to Alzheimer's disease in a subject in need thereof.
    Type: Application
    Filed: April 7, 2006
    Publication date: December 3, 2009
    Applicant: The Trustees of Columbia University in the City of New York
    Inventors: Ottavio V. Vitolo, Ottavio Arancio, Michael L. Shelanski
  • Ginkgolide Compounds, Compositions, And Extracts, And Uses Thereof
    Publication number: 20090156668
    Abstract: The present invention relates to Ginkgolide derivatives, compositions and extracts comprising one or more Ginkgolides and/or derivatives thereof and methods of use of the compositions to treat neurological disorders and as imaging agents.
    Type: Application
    Filed: March 21, 2005
    Publication date: June 18, 2009
    Applicant: The Trustees Of Columbia University In The City Of New York
    Inventors: Ottavio V. Vitolo, Koji Nakanishi, Michael L. Shelanski, Sonja Krane, Ottavio Arancio, Stanislav Jaracz, Nina D. Berova
  • Antisense compounds which prevent cell death and uses thereof
    Patent number: 7223856
    Abstract: The present invention provides for an antisense oligonucleotide having the sequence 5?GCTCGGCGCCGCCATTTCCAG3?. The invention also provides for an antisense oligonucleotide having the sequence 5?GTCAGCGGCCATCAGCTT3?. The present invention further provides for a method for treating a neurodegenerative disorder in a subject which comprises administering to the subject a compound in an amount effective to inhibit neuronal cell death and thus treat the neurodegenerative disorder in the subject, which compound comprises the oligonucleotide 5?GCTCGGCGCCGCCATTTCCAG3? and a delivery agent. The present invention provides for a method of inhibiting trophic factor withdrawal mediated death of a cell which comprises contacting the cell with an amount of the oligonucleotide 5?GCTCGGCGCCGCCATTTCCAG3? effective to inhibit death of the cell.
    Type: Grant
    Filed: June 28, 2002
    Date of Patent: May 29, 2007
    Assignee: The Trustees of Columbia University in the City of New York
    Inventors: Carol M. Troy, Michael L. Shelanski
  • Antisense oligonucleotides and related methods for regulating cell death
    Publication number: 20040254136
    Abstract: This invention provides a first nucleic acid which specifically hybridizes to a nucleic acid encoding an inhibitor-of-apoptosis protein. This invention also provides related compositions and methods for inducing cell death and treating cancer using same. This invention further provides a second nucleic acid which specifically hybridizes to a nucleic acid encoding a protein, other than caspase-2, that induces cell death. Finally, this invention provides related compositions and methods for inhibiting cell death, inhibiting neuronal cell death in particular, and treating a neurodegenerative disorder and a heart disorder using the second nucleic acid.
    Type: Application
    Filed: July 26, 2004
    Publication date: December 16, 2004
    Inventors: Carol M. Troy, Michael L. Shelanski
  • Antisense compounds which prevent cell death and uses thereof
    Publication number: 20030092659
    Abstract: The present invention provides for an antisense oligonucleotide having the sequence 5′GCTCGGCGCCGCCATTTCCAG3′. The invention also provides for an antisense oligonucleotide having the sequence 5′GTCAGCGGCCATCAGCTT3′. The present invention further provides for a method for treating a neurodegenerative disorder in a subject which comprises administering to the subject a compound in an amount effective to inhibit neuronal cell death and thus treat the neurodegenerative disorder in the subject, which compound comprises the oligonucleotide 5′GCTCGGCGCCGCCATTTCCAG3′ and a delivery agent. The present invention provides for a method of inhibiting trophic factor withdrawal mediated death of a cell which comprises contacting the cell with an amount of the oligonucleotide 5′GCTCGGCGCCGCCATTTCCAG3′ effective to inhibit death of the cell.
    Type: Application
    Filed: June 28, 2002
    Publication date: May 15, 2003
    Inventors: Carol M. Troy, Michael L. Shelanski
  • Antisense compounds which prevent cell death and uses thereof
    Patent number: 5929042
    Abstract: The present invention provides for an antisense oligonucleotide having the sequence 5'GCTCGGCGCCGCCATTTCCAG3'(SEQ ID NO:1). The invention also provides for an antisense oligonucleotide having the sequence 5'GTCAGCGGCCATCAGCTT3'(SEQ ID NO:2). The present invention further provides for a method for treating a neurodegenerative disorder in a subject which comprises administering to the subject a compound in an amount effective to inhibit neuronal cell death and thus treat the neurodegenerative disorder in the subject, which compound comprises the oligonucleotide 5'GCTCGGCGCCGCCATTTCCAG3' (SEQ ID NO:1) and a delivery agent. The present invention provides for a method of inhibiting trophic factor withdrawal mediated death of a cell which comprises contacting the cell with an amount of the oligonucleotide 5'GCTCGGCGCCGCCATTTCCAG3' (SEQ ID NO:1) effective to inhibit death of the cell.
    Type: Grant
    Filed: March 3, 1997
    Date of Patent: July 27, 1999
    Assignee: The Trustees of Columbia University in the City of New York
    Inventors: Carol M. Troy, Michael L. Shelanski