Patents by Inventor Michael Ruppert

Michael Ruppert has filed for patents to protect the following inventions. This listing includes patent applications that are pending as well as patents that have already been granted by the United States Patent and Trademark Office (USPTO).

  • MicroRNAs 206 and 21 cooperate to promote RAS-extracellular signal-regulated kinase signaling by suppressing the translation of RASA1 and SPRED1
    Patent number: 10221415
    Abstract: The present invention provides a method for inhibiting the RAS-ERK pathway by upregulation of RASA1 and SPRED1 mRNAs in tumor cells by anti-miR treatment. The method includes wherein an anti-miR-206 binds to a nucleotide comprising the sequence UAGCUUAUCAGACU (SEQ ID NO: 21), or to a nucleotide comprising the sequence UGGAAUGUAAGGAAGUGUGUGG (SEQ ID NO: 9). A method of re-expression of RAS-ERK pathway inhibitory proteins in triple negative cancer cells by administering to a patient having cancer an effective amount of an antagonist of KLF4-dependent microRNAs.
    Type: Grant
    Filed: August 31, 2016
    Date of Patent: March 5, 2019
    Assignee: West Virginia University
    Inventors: Sriganesh B. Sharma, Chen-Chung Lin, Mark K. Farrugia, J. Michael Ruppert
  • MicroRNAs 206 and 21 Cooperate To Promote RAS-Extracellular Signal-Regulated Kinase Signaling by Suppressing the Translation of RASA1 and SPRED1
    Publication number: 20170067049
    Abstract: The present invention provides a method for inhibiting the RAS-ERK pathway by upregulation of RASA1 and SPRED1 mRNAs in tumor cells by anti-miR treatment. The method includes wherein an anti-miR-206 binds to a nucleotide comprising the sequence UAGCUUAUCAGACU (SEQ ID NO: 21), or to a nucleotide comprising the sequence UGGAAUGUAAGGAAGUGUGUGG (SEQ ID NO: 9). A method of re-expression of RAS-ERK pathway inhibitory proteins in triple negative cancer cells by administering to a patient having cancer an effective amount of an antagonist of KLF4-dependent microRNAs.
    Type: Application
    Filed: August 31, 2016
    Publication date: March 9, 2017
    Inventors: Sriganesh B. Sharma, Chen-Chung Lin, Mark K. Farrugia, J. Michael Ruppert
  • Krüppel-like transcriptional factor KLF4/GKLF and uses thereof
    Patent number: 7364868
    Abstract: The present invention proivdes methods of identifying new carcinoma oncogenes or analyzing functions of known carcinoma oncogenes by transformation of RK3E cells. Also provided are methods of using nuclear localization of Krüppel-like factor 4 (KLF4, or termed Gut-Enriched Krüppel-Like Factor, GKLF) as a marker and prognostic factor for aggressive early-stage breast carcinoma.
    Type: Grant
    Filed: February 11, 2004
    Date of Patent: April 29, 2008
    Assignee: The UAB Research Foundation
    Inventors: J. Michael Ruppert, Jeffrey Allen Engler
  • Kruppel-like transcriptional factor KLF4/GKLF and uses thereof
    Publication number: 20040235073
    Abstract: The present invention proivdes methods of identifying new carcinoma oncogenes or analyzing functions of known carcinoma oncogenes by transformation of RK3E cells. Also provided are methods of using nuclear localization of Krüppel-like factor 4 (KLF4, or termed Gut-Enriched Krüppel-Like Factor, GKLF) as a marker and prognostic factor for aggressive early-stage breast carcinoma.
    Type: Application
    Filed: February 11, 2004
    Publication date: November 25, 2004
    Inventors: J. Michael Ruppert, Jeffrey Allen Engler
  • Oncogene identification by transformation of RK3E cells and uses thereof
    Publication number: 20030138799
    Abstract: The present invention is directed to methods of identifying new carcinoma oncogenes or analyzing functions of known carcinoma oncogenes by transformation of RK3E cells. Also provided are methods of identifying oncogene-specificity of known drugs or screening for new drugs that inhibit oncogenes activated in carcinoma by utilizing RK3E cells. Further provided are methods of identifying alterations in cellular enzyme, protein, or mRNA levels or activities by utilizing RK3E and oncogene-transformed derivatives. Still further provided are a novel oncogene GKLF with cDNA sequence and amino acid sequence for the protein, and applications of such gene/protein in medical diagnosis and treatment.
    Type: Application
    Filed: July 12, 2002
    Publication date: July 24, 2003
    Inventors: J. Michael Ruppert, Jeffrey Allen Engler
  • Method for the reliable determination of the distance of the conductive reaction track from a functional surface of a magnetic levitation vehicle moving relative to the reaction track and a sensor for performing the method
    Patent number: 5764050
    Abstract: In a method for measuring a distance between a conducting reaction track and a functional surface moving relative to the reaction track a sensor with two signal transmitters is provided on the functional surface. An alternating field is generated in the sensor. The alternating field changes as a function of the distance between the conducting reaction track and the functional surface. Each of the two signal transmitters detects the changes of the alternating field as distance information. Each signal transmitter produces decoupled distance information values. These decoupled distance information values are processed in separate distance measuring channels to provide processed signals. The processed signals are constantly fed to and compared in a comparator. A distance information signal is emitted only when the processed signals of the separate distance measuring channels are identical within a predetermined tolerance range.
    Type: Grant
    Filed: July 11, 1996
    Date of Patent: June 9, 1998
    Assignee: Thyssen Industrie AG
    Inventors: Siegfried Ellmann, Joachim Klesing, Michael Ruppert, Josef Eder