Patents by Inventor Nancy Berman

Nancy Berman has filed for patents to protect the following inventions. This listing includes patent applications that are pending as well as patents that have already been granted by the United States Patent and Trademark Office (USPTO).

  • Use of cripto-1 as a biomarker for neurodegenerative disease and method of inhibiting progression thereof
    Publication number: 20070122813
    Abstract: A method of detecting a neurodegenerative disease in a mammal, which method comprises assaying the copy number of a Cripto-1 gene or the expression level of a Cripto-1 gene product in the central nervous system of the mammal, wherein an amplification of the Cripto-1 gene or an overexpression of the Cripto-1 gene product is indicative of a neurodegenerative disease in the mammal; a method of inhibiting progression of a neurodegenerative disease in a mammal, which method comprises administering to the mammal an agent that inhibits Cripto-1 in an amount effective to inhibit Cripto-1 in the central nervous system of the mammal, whereupon the progression of the neurodegenerative disease is inhibited; and an isolated or purified oligonucleotide consisting essentially of the sequence of AAGCTATGGACTGCAGGAAGATGG (SEQ ID NO: 3) or AGAAGGCAGATGCCACTAGC (SEQ ID NO: 4).
    Type: Application
    Filed: October 1, 2004
    Publication date: May 31, 2007
    Inventors: David Salomon, Nancy Berman, Edward Stephens