Patents by Inventor Nari BYUN

Nari BYUN has filed for patents to protect the following inventions. This listing includes patent applications that are pending as well as patents that have already been granted by the United States Patent and Trademark Office (USPTO).

  • Publication number: 20240182855
    Abstract: The present disclosure provides a method for producing a population of regulatory T cells comprising culturing an initial population of regulatory T cells obtained from umbilical cord blood in a media comprising an oligonucleotide having the sequence of AATCGTAACCGTCGTATCGGCGAT (SEQ ID NO: 1) to expand the initial population of regulatory T cells, a method of treating an autoimmune disease comprising administering to a subject in need thereof an effective amount of a composition comprising the regulatory T cells prepared by the above method, and a composition for treating an autoimmune disease, the composition comprising the regulatory T cells.
    Type: Application
    Filed: March 31, 2022
    Publication date: June 6, 2024
    Inventors: Yong Chan KIM, Nari BYUN, Jeong Heon YOON
  • Patent number: 11597912
    Abstract: The present disclosure provides a method for producing a population of regulatory T cells comprising culturing an initial population of regulatory T cells obtained from umbilical cord blood in a media comprising an oligonucleotide having the sequence of AATCGTAACCGTCGTATCGGCGAT (SEQ ID NO: 1) to expand the initial population of regulatory T cells, and a method of treating an autoimmune disease comprising administering to a subject in need thereof an effective amount of a composition comprising the regulatory T cells prepared by the above method.
    Type: Grant
    Filed: March 31, 2022
    Date of Patent: March 7, 2023
    Assignee: TERAIMMUNE, INC.
    Inventors: Yong Chan Kim, Nari Byun, Jeong Heon Yoon
  • Publication number: 20220325243
    Abstract: The present disclosure provides a method for producing a population of regulatory T cells comprising culturing an initial population of regulatory T cells obtained from umbilical cord blood in a media comprising an oligonucleotide having the sequence of AATCGTAACCGTCGTATCGGCGAT (SEQ ID NO: 1) to expand the initial population of regulatory T cells, and a method of treating an autoimmune disease comprising administering to a subject in need thereof an effective amount of a composition comprising the regulatory T cells prepared by the above method.
    Type: Application
    Filed: March 31, 2022
    Publication date: October 13, 2022
    Applicant: TERAIMMUNE, INC.
    Inventors: Yong Chan KIM, Nari BYUN, Jeong Heon YOON