Patents by Inventor Nicola DE PRISCO

Nicola DE PRISCO has filed for patents to protect the following inventions. This listing includes patent applications that are pending as well as patents that have already been granted by the United States Patent and Trademark Office (USPTO).

  • Publication number: 20240263191
    Abstract: The present invention relates to a nucleic acid construct allowing to drives the expression of a transcription factor in rod cells or cone cells thereby silencing the expression of a gene which mutated form is responsible for a retinal dystrophy and its medical use, relative expression vector, host cell, viral particle and pharmaceutical composition.
    Type: Application
    Filed: December 21, 2018
    Publication date: August 8, 2024
    Applicant: UNIVERSITA DI NAPOLI FEDERICO II
    Inventors: Enrico Maria SURACE, Salvatore BOTTA, Elena MARROCCO, Nicola DE PRISCO
  • Patent number: 11096955
    Abstract: The present invention relates to the treatment and/or prevention of a retinal disease by using a polynucleotide promoter wherein the polynucleotide or a variant thereof consists of the sequence (hRHOs-wt;?SEQ?ID?NO.?1) TCCTCCTAGTGTCACCTTGGCCCCTCTTAGAAGCCAATTAGGCCCTCAG TTTCTGCAGCGGGGATTAATATGATTATGAACACCCCCAATCTCCCAGA TGCTGATTCAGCCAGGAGCTTAGGAGGGGGAGGTCACTTTATAAGGGTC TGGGGGGGTCAGAACCCAGAGTCATCCAGCTGGAGCCCTGAGTGGCTGA GCTCAGGCCTTCGCAGCATTCTTGGGTGGGAGCAGCCACGGGTCAGCCA CAAGGGCCACAGCC? wherein the fragment TGAACACCCCCAATCTCCCAGATGCT which is the sequence from nucleotide 77 to nucleotide 102 of SEQ ID NO. 1, is substituted. The invention is also directed to the use of relative vector, vector systems, host cells and pharmaceutical compositions.
    Type: Grant
    Filed: February 9, 2017
    Date of Patent: August 24, 2021
    Assignee: Fondazione Telethon
    Inventors: Enrico Maria Surace, Mariangela Lupo, Salvatore Botta, Elena Marrocco, Nicola De Prisco
  • Publication number: 20190038660
    Abstract: The present invention relates to the treatment and/or prevention of a retinal disease by using a polynucleotide promoter wherein the polynucleotide or a variant thereof consists of the sequence (hRHOs-wt;?SEQ?ID?NO.?1) TCCTCCTAGTGTCACCTTGGCCCCTCTTAGAAGCCAATTAGGCCCTCAG TTTCTGCAGCGGGGATTAATATGATTATGAACACCCCCAATCTCCCAGA TGCTGATTCAGCCAGGAGCTTAGGAGGGGGAGGTCACTTTATAAGGGTC TGGGGGGGTCAGAACCCAGAGTCATCCAGCTGGAGCCCTGAGTGGCTGA GCTCAGGCCTTCGCAGCATTCTTGGGTGGGAGCAGCCACGGGTCAGCCA CAAGGGCCACAGCC wherein the fragment TGAACACCCCCAATCTCCCAGATGCT which is the sequence from nucleotide 77 to nucleotide 102 of SEQ ID NO. 1, is substituted. The invention is also directed to the use of relative vector, vector systems, host cells and pharmaceutical compositions.
    Type: Application
    Filed: February 9, 2017
    Publication date: February 7, 2019
    Inventors: Enrico Maria SURACE, Mariangela LUPO, Salvatore BOTTA, Elena MARROCCO, Nicola DE PRISCO