Abstract: The invention provides anti-TIM3 antibodies and methods of using the same.

Abstract: The present invention relates to anti-PD1 antibodies and methods of using the same.

Abstract: The present invention relates to anti-PD1 antibodies and methods of using the same.

Abstract: Herein is reported a nucleic acid comprising in 5? to 3? direction i) a first nucleic acid fragment encoding a polypeptide of interest without an in frame translational stop codon, ii) a second nucleic acid fragment operably linked to said first nucleic acid fragment which is beginning with the 5? splice donor site of an immunoglobulin heavy chain CH3 or CH4 domain and which is terminated by the 3? splice acceptor site of the succeeding immunoglobulin heavy chain transmembrane domain exon M1 and which comprises in frame translational stop codon and a polyadenylation signal, and iii) a third nucleic acid fragment operably linked to said second nucleic acid encoding at least a fragment of a transmembrane domain, wherein the second nucleic acid fragment has at its 3? terminus the nucleotide sequence CTACCACCCCCTTCCTGTCCAG (SEQ ID NO: 29) or TGACCACGCCAATCGTGTCCAG (SEQ ID NO: 14) or CTACCACGCCAATCGTGTCCAG (SEQ ID NO: 31).

Abstract: The invention provides anti-TIM3 antibodies and methods of using the same.

Abstract: Herein is reported a nucleic acid comprising in 5? to 3? direction i) a first nucleic acid fragment encoding a polypeptide of interest without an in frame translational stop codon, ii) a second nucleic acid fragment operably linked to said first nucleic acid fragment which is beginning with the 5? splice donor site of an immunoglobulin heavy chain CH3 or CH4 domain and which is terminated by the 3? splice acceptor site of the succeeding immunoglobulin heavy chain transmembrane domain exon M1 and which comprises in frame translational stop codon and a polyadenylation signal, and iii) a third nucleic acid fragment operably linked to said second nucleic acid encoding at least a fragment of a transmembrane domain, wherein the second nucleic acid fragment has at its 3? terminus the nucleotide sequence CTACCACCCCCTTCCTGTCCAG (SEQ ID NO: 29) or TGACCACGCCAATCGTGTCCAG (SEQ ID NO: 14) or CTACCACGCCAATCGTGTCCAG (SEQ ID NO: 31).

Abstract: The invention provides anti-TIM3 antibodies and methods of using the same.

Abstract: The present invention relates to anti-PD1 antibodies and methods of using the same.

Abstract: The invention provides anti-TIM3 antibodies and methods of using the same.

Abstract: The present invention relates to anti-PD1 antibodies and methods of using the same.

Abstract: The invention provides anti-TIM3 antibodies and methods of using the same.

Abstract: The current invention describes a nucleic acid comprising in a 5? to 3? direction a) a first nucleic acid encoding a heterologous polypeptide without an in frame stop codon, b) a second nucleic acid beginning with a 5? splice donor site and terminated by a 3? splice acceptor site comprising an in frame translational stop codon and a polyadenylation signal, and c) a nucleic acid encoding i) at least a fragment of a transmembrane domain, or ii) a signal peptide for a GPI-anchor.

Abstract: The current invention describes a nucleic acid comprising in a 5? to 3? direction a) a first nucleic acid encoding a heterologous polypeptide without an in frame stop codon, b) a second nucleic acid beginning with a 5? splice donor site and terminated by a 3? splice acceptor site comprising an in frame translational stop codon and a polyadenylation signal, and c) a nucleic acid encoding i) at least a fragment of a transmembrane domain, or ii) a signal peptide for a GPI-anchor.

Abstract: The current invention comprises a nucleic acid encoding the amino acid sequence of the C-terminal part of the CH3-domain of an immunoglobulin of the class IgA or IgG, or the C-terminal part of the CH4-domain of an immunoglobulin of the class IgE or IgM, wherein the glycine-lysine-dipeptide comprised in the amino acid sequence of the C-terminal part of the CH3- or CH4-domain is encoded by the nucleic acid ggaaaa, or the nucleic acid ggcaaa, or the nucleic acid gggaaa, or the nucleic acid gggaag, or the nucleic acid ggcaag, or the nucleic acid ggaaag.

Abstract: The current invention comprises a nucleic acid encoding the amino acid sequence of the C-terminal part of the CH3-domain of an immunoglobulin of the class IgA or IgG, or the C-terminal part of the CH4-domain of an immunoglobulin of the class IgE or IgM, wherein the glycine-lysine-dipeptide comprised in the amino acid sequence of the C-terminal part of the CH3- or CH4-domain is encoded by the nucleic acid ggaaaa, or the nucleic acid ggcaaa, or the nucleic acid gggaaa, or the nucleic acid gggaag, or the nucleic acid ggcaag, or the nucleic acid ggaaag.

Abstract: The current invention describes a nucleic acid comprising in a 5? to 3? direction a) a first nucleic acid encoding a heterologous polypeptide without an in frame stop codon, b) a second nucleic acid beginning with a 5? splice donor site and terminated by a 3? splice acceptor site comprising an in frame translational stop codon and a polyadenylation signal, and c) a nucleic acid encoding i) at least a fragment of a transmembrane domain, or ii) a signal peptide for a GPI-anchor.