Abstract: The present disclosure provides a method for producing a population of regulatory T cells comprising culturing an initial population of regulatory T cells obtained from umbilical cord blood in a media comprising an oligonucleotide having the sequence of AATCGTAACCGTCGTATCGGCGAT (SEQ ID NO: 1) to expand the initial population of regulatory T cells, a method of treating an autoimmune disease comprising administering to a subject in need thereof an effective amount of a composition comprising the regulatory T cells prepared by the above method, and a composition for treating an autoimmune disease, the composition comprising the regulatory T cells.

Abstract: A window manufacturing apparatus includes a transporting table on which a target substrate is to be mounted, the transporting table including a first portion and a second portion having a greater thickness than the first portion, a plurality of suctioning ports on a suctioning table, the plurality of suctioning ports being configured to suction the target substrate, and an attachment device configured to attach a protective film to the target substrate suctioned to the suctioning table. In a state in which the target substrate mounted on the transporting table is suctioned to the suctioning table, the plurality of suctioning ports overlap the second portion of the transporting table and do not overlap the first portion of the transporting table in a plan view.

Abstract: The present disclosure relates to a cell culture composition including a Chlorella extract. According to the cell culture medium composition including the Chlorella extract according to an aspect, the medium including the Chlorella extract can improve the cell proliferation ability of bovine myogenic stem cells. Thus, the Chlorella extract can be used as a substitute for fetal bovine serum.

Abstract: An embodiment integrated-type air-conditioning system includes a refrigerant circuit including first and second refrigerant lines, a first coolant circuit including a battery, and a second coolant circuit including a PE part. The first refrigerant line includes a compressor, an indoor heat exchanger, a first expansion device, and an outdoor heat exchanger, and the second refrigerant line includes a second expansion device and an integrated heat exchanger. The second refrigerant line branches from a branch point between the indoor heat exchanger and the first expansion device in the first refrigerant line and branches from a point between the compressor and the indoor heat exchanger through a switching valve to be connected to the compressor. The first coolant circuit and the second coolant circuit are each connected to the integrated heat exchanger so as to allow a coolant to exchange heat with a refrigerant.

Abstract: The present disclosure relates to a citrate synthase variant, a microorganism comprising the variant, and a method for producing L-amino acids using the microorganism.

Abstract: A vehicular heat management system includes a refrigerant circulation line configured to generate hot energy or cold energy depending on a flow direction of a refrigerant, a heater core side coolant circulation line configured to transfer refrigerant heat generated in the refrigerant circulation line to a heater core to heat a passenger compartment, and a battery side coolant circulation line configured to receive coolant heat of the heater core side coolant circulation line via a coolant and then circulate the coolant through a battery to preheat the battery.

Abstract: A washing machine includes a tub; a rotating tub rotatably provided in the tub; a pulsator rotatably provided in a lower portion of the rotating tub; a washing rod configured to be coupled to the pulsator; a sensor configured to detect coupling or decoupling of the washing rod and the pulsator; a control panel configured to display a plurality of washing modes; and a controller configured to be electrically connected to the sensor and the control panel, wherein the controller is configured to identify whether the pulsator and the washing rod are coupled based on a detection signal of the sensor, and control the control panel to display at least one washing mode corresponding to a coupled state of the washing rod or a decoupled state of the washing rod among the plurality of washing modes.

Abstract: An embodiment heat pump system of a vehicle includes a first cooling device including an electrical component and a first line for circulating a coolant, a second cooling device including a battery module and a second line for circulating the coolant, a HVAC module connected through a refrigerant line and internally provided with an opening/closing door that adjusts a selective flow of ambient air according to a cooling, heating, or heating and dehumidifying mode of a vehicle interior, a heat-exchanger connected to the internal condenser through the refrigerant line, a first expansion valve on the refrigerant line and connecting the heat-exchanger and the evaporator, a compressor connected between the evaporator and the internal condenser through the refrigerant line, an accumulator on the refrigerant line between the evaporator and the compressor, a chiller, a second expansion valve, a third expansion valve, and a second connection line.

Abstract: A system and method that include receiving a well plan and determining a plurality of sections of the well plan and receiving data from surface and downhole to determine a current location of a drill bit. The system and method also include analyzing the well plan to automatically derive trajectory constraints that are associated with each of the plurality of sections of the well plan and determining a plurality of trajectory candidates that pertain to respective paths from the current location of the drill bit to respective targets based on a consideration of the trajectory constraints. The system and method further include determining costs according to at least one cost function to rank the plurality of trajectory candidates to determine a working plan that includes an optimal path from the current location of the drill bit to reach a final target.

Abstract: An air-conditioning and humidity control system for a mobility vehicle that includes a cold air generating part configured to cool air by allowing the air to exchange heat with a refrigerant, a warm air generating part configured to heat air by allowing the air to exchange heat with the refrigerant, a moisture capturing part configured to capture condensate water generated by the heat exchange in the cold air generating part, and a moisture providing part configured to selectively transfer the condensate water captured by the moisture capturing part to the warm air generating part.

Abstract: The present invention relates to: a steel material for hot forming, used for a vehicle and the like; a hot-formed member; and a method for manufacturing same. In the method, when the formed steel material is skin pass rolled, rolling pressure and roughness of skin pass rolling rolls are controlled so that bendability can be improved.

Abstract: A foldable lens box blank which may be used to form an ophthalmic lens box. The ophthalmic lens box includes a pair of lens holders each being configured to hold and store an ophthalmic lens. Each of the lens holders includes a lens support opening in which a lens may be secured, with an outer edge of each lens engaging with an inner edge of each lens support opening.

Abstract: A semiconductor manufacturing device has a cooling pad with a plurality of movable pins. The cooling pad includes a fluid pathway and a plurality of springs disposed in the fluid pathway. Each of the plurality of springs is disposed under a respective movable pin. A substrate includes an electrical component disposed over a surface of the substrate. The substrate is disposed over the cooling pad with the electrical component oriented toward the cooling pad. A force is applied to the substrate to compress the springs. At least one of the movable pins contacts the substrate. A cooling fluid is disposed through the fluid pathway.

Abstract: The present disclosure relates to the pharmaceutical use of antagonists (e.g., an antibody or antigen-binding portion thereof) that specifically bind to FAM19A5 to treat a glaucoma in a subject in need thereof.

Abstract: Provided are an epitaxial growth apparatus and a multi-layer gas supply module used therefor, the epitaxial growth apparatus including: a reaction chamber; a susceptor positioned in the reaction chamber and configured to seat a wafer thereon; and a multi-layer gas supply module configured to supply a gas to the reaction chamber to form an epitaxial layer on the wafer, wherein the multi-layer gas supply module includes an injector including ports of a plurality of layers, each of which discharges a different gas for each layer, among the ports of the plurality of layers, the ports of each layer including a center port corresponding to a central region of the wafer, and a pair of edge ports corresponding to both edge regions of the wafer, and a flow distribution unit configured to distribute gas flows input to the center port and the edge port among the ports of each layer independently from each other.

Abstract: The present invention relates to an anti-CNTN4 antibody or an antigen-binding fragment thereof, a pharmaceutical composition containing the same, and a use thereof for activating T cells upregulating cell-mediated immune responses, for example, for treating cancer.

Abstract: An air conditioner includes a housing comprising an outlet, a panel attachable to or detachable from a lower side of the housing, the panel comprising an inlet to introduce air therethrough, a first filter installable to the panel to filter the introduced air, a second filter installable to the panel at an upper side of the first filter and configured to further filter the introduced air, and a lifter configured to detach the panel from the lower side of the housing by lowering the panel from an initial position to a maintenance position in a vertical direction, and to attach the panel to the lower side of the housing by lifting the panel from the maintenance position to the initial position in the vertical direction. By lowering the panel to the maintenance position, one or more of the first filter and the second filter are accessible for the maintenance.

Abstract: The present invention relates to a liquid butadiene compound with both ends modified, a method for preparing same, and a use thereof. More specifically, the present invention provides a liquid butadiene rubber compound with both ends modified that is synthesized using a chain transfer agent having a triethoxysily functional group and a tetrasulfide functional group, and a 1,3-butadiene monomer, a rubber composition for a tire comprising same, a method for preparing same, and the like. According to the present invention, by introducing a silica-friendly functional group at both ends of the chain, hysteresis or the like caused by the chain ends of an existing liquid butadiene rubber is controlled, and thus, various performances affecting fuel efficiency characteristics can be improved.

Abstract: A method of calibrating a zero point of a mass flow control device includes closing a valve installed in a main flow path of the mass flow control device to block the main flow path and prevent a fluid from flowing in the main flow path, determining, based on a pressure value measured using a pressure meter installed in the main flow path, whether the fluid has stopped flowing, determining, based on a flowrate value measured by a flowrate sensor provided on a sensor flow path connected to the main flow path, whether the fluid is stable, calculating a zero point calibration value based on a temperature value of the fluid measured by a thermometer installed in the main flow path and the flowrate value measured by the flowrate sensor, and applying the zero point calibration value to a zero point of the flowrate sensor.

Abstract: A dispersant according to an example embodiment of the present disclosure includes a polyvinyl acetal-based resin satisfying a degree of polymerization of 100 or more and 500 or less, a molecular weight of 10000 g/mol or more and 30000 g/mol or less, and an average diameter of 400 ?m or more and 5500 ?m or less.