Abstract: A drive arrangement for a motor vehicle flap including a gas pressure element, the gas pressure element has an outwardly sealed cylinder and a piston moveable in the cylinder interior along the cylinder axis and subdivides the cylinder interior into two sub-chambers, the gas pressure element has a first drive connection connected to the cylinder, and a second drive connection connected to the piston, the cylinder filled with a fluid and the piston has an overflow channel arrangement to create a balancing flow between the two sub-chambers to balance a pressure drop between the two sub-chambers. The piston is assigned a switchable valve arrangement which, depending on the pressure drop between the two sub-chambers, to create different through-flow states differing the cross section of the overflow channel arrangement. Upon exceeding a predetermined threshold for the pressure drop, the valve arrangement switches to change the cross section of the overflow channel arrangement.

Abstract: The present invention responds to the need to provide an endogenous miRNA for quantifying the amount of one or more targets miRNA in exosomes using normalization, that that does not vary within the different tumor types and within the different chemotherapeutic treatments. This is essential to be able to perform robust analysis of the expression of exosomal miRNAs in these pathologies. So far, other types of endogenous controls have been used that are not strictly exosomal, thus reducing their reliability as normalizers. Therefore, for the first time, an endogenous control specific for the exosomal compartment would be available.

Abstract: Sliding door for motor vehicles, having an outer door skin, an inner door skin and a door inside trim, supported on a guide rail on a vehicle body and movable between opened and closed positions. The sliding door includes a cable guide assembly for accommodating and guiding electric cables, which connect first electric elements provided in or on the vehicle body to second electric elements provided on the sliding door, whereby on moving the sliding door, the cable guide assembly is movable in a plane including the longitudinal direction of the vehicle and whereby a guide channel for guiding the cable guide assembly is provided on moving the sliding door. Guide surfaces of the guide channel are formed or integrated at least in sections on the inner door skin, in a door module support and/or on the door inside trim.

Abstract: A sliding door for a motor vehicle which may be moved along a direction of displacement for opening and closing a door opening in the motor vehicle body is provided. The sliding door comprising a sliding door drive for producing a drive torque, a force transmitting mechanism and at least one further device for actuating an adjusting part of the sliding door. At least parts of the sliding door drive and parts of the further device for actuating an adjusting part have been pre-assembled on a module support outside the sliding door and the module support is arranged and secured as a pre-constructed module to the sliding door, together with the parts pre-assembled thereon outside the sliding door.

Abstract: Sliding door for motor vehicles, having an outer door skin, an inner door skin and a door inside trim, supported on a guide rail on a vehicle body and which is movable between an opened and closed positions. The sliding door includes a cable guide assembly for accommodating and guiding electric cables, which connect first electric elements provided in or on the vehicle body to second electric elements provided on the sliding door, whereby on moving the sliding door, the cable guide assembly is movable in a plane including the longitudinal direction of the vehicle and whereby a guide channel for guiding the cable guide assembly is provided on moving the sliding door. Guide surfaces of the guide channel are formed or integrated at least in sections on the inner door skin, in a door module support and/or on the door inside trim.

Abstract: A method for detecting the fungus Stachybotrys chartarum includes isolating DNA from a sample suspected of containing the fungus Stachybotrys chartarum. The method further includes subjecting the DNA to polymerase chain reaction amplification utilizing at least one of several primers, the several primers each including one of the base sequences 5′GTTGCTTCGGCGGGAAC3′, 5′TTTGCGTTTGCCACTCAGAG3′, 5′ACCTATCGTTGCTTCGGCG3′, and 5′GCGTTTGCCACTCAGAGAATACT3′. The method additionally includes detecting the fungus Stachybotrys chartarum by visualizing the product of the polymerase chain reaction.

Abstract: A method for detecting the fungus Stachybotrys chartarum includes isolating DNA from a sample suspected of containing the fungus Stachybotrys chartarum. The method further includes subjecting the DNA to polymerase chain reaction amplification utilizing at least one of several primers, the several primers each including one of the base sequences 5′GTTGCTTCGGCGGGAAC3′, 5′TTTGCGTTTGCCACTCAGAG3′, 5′ACCTATCGTTGCTTCGGCG3′, and 5′GCGTTTGCCACTCAGAGAATACT3′. The method additionally includes detecting the fungus Stachybotrys chartarum by visualizing the product of the polymerase chain reaction.

Abstract: A method for detecting the fungus Stachybotrys chartarum includes isolating DNA from a sample suspected of containing the fungus Stachybotrys chartarum. The method further includes subjecting the DNA to polymerase chain reaction amplification utilizing at least one of several primers, the several primers each including one of the base sequences 5′GTTGCTTCGGCGGGAAC3′, 5′TTTGCGTTTGCCACTCAGAG3′, 5′ACCTATCGTTGCTTCGGCG3′, and 5′GCGTTTGCCACTCAGAGAATACT3′. The method additionally includes detecting the fungus Stachybotrys chartarum by visualizing the product of the polymerase chain reaction.