Patents by Inventor Patricia Cruz-Perez

Patricia Cruz-Perez has filed for patents to protect the following inventions. This listing includes patent applications that are pending as well as patents that have already been granted by the United States Patent and Trademark Office (USPTO).

  • Publication number: 20040157260
    Abstract: A method for detecting the fungus Stachybotrys chartarum includes isolating DNA from a sample suspected of containing the fungus Stachybotrys chartarum. The method further includes subjecting the DNA to polymerase chain reaction amplification utilizing at least one of several primers, the several primers each including one of the base sequences 5′GTTGCTTCGGCGGGAAC3′, 5′TTTGCGTTTGCCACTCAGAG3′, 5′ACCTATCGTTGCTTCGGCG3′, and 5′GCGTTTGCCACTCAGAGAATACT3′. The method additionally includes detecting the fungus Stachybotrys chartarum by visualizing the product of the polymerase chain reaction.
    Type: Application
    Filed: March 19, 2004
    Publication date: August 12, 2004
    Inventors: Patricia Cruz-Perez, Mark P. Buttner
  • Patent number: 6733999
    Abstract: A method for detecting the fungus Stachybotrys chartarum includes isolating DNA from a sample suspected of containing the fungus Stachybotrys chartarum. The method further includes subjecting the DNA to polymerase chain reaction amplification utilizing at least one of several primers, the several primers each including one of the base sequences 5′GTTGCTTCGGCGGGAAC3′, 5′TTTGCGTTTGCCACTCAGAG3′, 5′ACCTATCGTTGCTTCGGCG3′, and 5′GCGTTTGCCACTCAGAGAATACT3′. The method additionally includes detecting the fungus Stachybotrys chartarum by visualizing the product of the polymerase chain reaction.
    Type: Grant
    Filed: February 22, 2002
    Date of Patent: May 11, 2004
    Assignee: University of Nevada
    Inventors: Patricia Cruz-Perez, Mark P. Buttner
  • Publication number: 20030054369
    Abstract: A method for detecting the fungus Stachybotrys chartarum includes isolating DNA from a sample suspected of containing the fungus Stachybotrys chartarum. The method further includes subjecting the DNA to polymerase chain reaction amplification utilizing at least one of several primers, the several primers each including one of the base sequences 5′GTTGCTTCGGCGGGAAC3′, 5′TTTGCGTTTGCCACTCAGAG3′, 5′ACCTATCGTTGCTTCGGCG3′, and 5′GCGTTTGCCACTCAGAGAATACT3′. The method additionally includes detecting the fungus Stachybotrys chartarum by visualizing the product of the polymerase chain reaction.
    Type: Application
    Filed: February 22, 2002
    Publication date: March 20, 2003
    Inventors: Patricia Cruz-Perez, Mark P. Buttner