Abstract: A genetically modified vertebrate is provided that has an enhanced sense due to an over representation of a predetermined odorant receptor. The vertebrate is genetically modified by introduction of DNA that comprises at least four sequential repeats of a sequence whose primary structure is at least 90% homologous with ACATAACTTTTTAATGAGTCT (SEQ ID NO: 1). The DNA causes a nearby odorant receptor coding sequence to be over represented in a singular gene choice fashion relative to a corresponding vertebrate that lacks the DNA.

Abstract: Provided herein are biosensors and methods for detecting one or more odorants associated with the levels, or a change in the levels, of one or more neurotransmitters in the central nervous system of a subject. In embodiments, provided are biosensors that comprise one or more populations of olfactory neurons, or cilia derived therefrom, wherein each population preferentially expresses a specific odorant receptor (OR). Also provided are biosensors comprising a cell or a population of cells engineered to express certain ORs; biosensors comprising certain isolated ORs; transgenic animals and tissues derived therefrom that preferentially express certain ORs; isolated cells or populations of cells engineered to express certain ORs; expression constructs for the preferential expression of certain ORs; and methods of using the biosensors, transgenic animals, tissues, cells, population of cells, and expression constructs disclosed herein.

Abstract: A biosensor for detecting trinitrotoluene (TNT) is disclosed. The biosensor has cells, such as olfactory sensory neurons (or cilia derived therefrom), that preferentially express a TNT-responsive odorant receptor protein.

Abstract: A genetically modified vertebrate is provided that has an enhanced sense due to an over representation of a predetermined odorant receptor. The vertebrate is genetically modified by introduction of DNA that comprises at least four sequential repeats of a sequence whose primary structure is at least 90% homologous with ACATAACTTTTTAATGAGTCT (SEQ ID NO: 1). The DNA causes a nearby odorant receptor coding sequence to be over represented in a singular gene choice fashion relative to a corresponding vertebrate that lacks the DNA.

Abstract: A genetically modified vertebrate is provided that has an enhanced sense due to an over representation of a predetermined odorant receptor. The vertebrate is genetically modified by introduction of DNA that comprises at least four sequential repeats of a sequence whose primary structure is at least 90% homologous with ACATAACTTTTTAATGAGTCT (SEQ ID NO: 1). The DNA causes a nearby odorant receptor coding sequence to be over represented in a singular gene choice fashion relative to a corresponding vertebrate that lacks the DNA.

Abstract: A biosensor for detecting trinitrotoluene (TNT) is disclosed. The biosensor has cells, such as olfactory sensory neurons (or cilia derived therefrom), that preferentially express a TNT-responsive odorant receptor protein.

Abstract: A genetically modified vertebrate is provided that has an enhanced sense due to an over representation of a predetermined odorant receptor. The vertebrate is genetically modified by introduction of DNA that comprises at least four sequential repeats of a sequence whose primary structure is at least 90% homologous with ACATAACTTTTTAATGAGTCT (SEQ ID NO: 1). The DNA causes a nearby odorant receptor coding sequence to be over represented in a singular gene choice fashion relative to a corresponding vertebrate that lacks the DNA.

Abstract: A precast slab gel for use in submerged (“submarine”) horizontal electrophoresis is formed in a tray that includes a flat base and two raised walls on opposing sides of the base, the walls containing one or more tabs on their outer surfaces, the tabs mating with grooves in the interior walls of the tank. The mating of the tabs with the grooves prevents movement and floating of the tray within to the electrophoresis cell during use. The tabs are designed to mate with grooves that are present in the tank for other purposes, which adds to the versatility of the design. Further versatility is achieved by joining the tabs to the tray walls by thin webs, which make the tabs readily removable, thereby rendering the tray usable in cell tanks that do not contain grooves.

Abstract: A precast slab gel for use in submerged (“submarine”) horizontal electrophoresis is formed in a tray that includes a flat base and two raised walls on opposing sides of the base, the walls containing one or more tabs on their outer surfaces, the tabs mating with grooves in the interior walls of the tank. The mating of the tabs with the grooves prevents movement and floating of the tray within to the electrophoresis cell during use. The tabs are designed to mate with grooves that are present in the tank for other purposes, which adds to the versatility of the design. Further versatility is achieved by joining the tabs to the tray walls by thin webs, which make the tabs readily removable, thereby rendering the tray usable in cell tanks that do not contain grooves.

Abstract: A controller (30) based chromatography system (2) especially designed for flexibility of operation with ease of use and an icon based control panel (32), has a number of function panels (34), each having a function key (36), one or more indicator indicia (40) in the form of icons, letters or numbers, and associated indicator lights (38). A switching valve (4) is used to provide a mixture of two or more solvents (6, 8) to a peristaltic pump (12). The cyclic nature of the pump and mixer can create a resonant condition resulting in poor quality information from the UV monitor (20). The system minimizes this by the judicious selection of the total cycle time T for the switching valve. This can be done using a random number manipulated in a manner to come up with each time T. Alternatively, an irrational number is combined with the pulsation frequency of the pump to create each time T.

Abstract: Microelectrodes of the art are limited to the charge density which can pass through them. The present invention discloses a method for electroplating iridium metal onto the surface of a metallic microelectrode for use in a biomedical prosthetic device, which method comprises:(a) placing the metallic microelectrode into an aqueous solution of iridium ion of between about 1 and 10 percent by weight; and(b) electroplating the microelectrode of step (a) using a current of between about 0.5 and 15 milliamps wherein said current is controlled by a current controller. In another aspect the method discloses in step (b) the current is also biased and simultaneously applied in a mode wherein the current is equivalent to an impressed voltage of between about 1.5 and 6.0 volts positive.In other aspects, the method also includes the following :A-after step (b): (c) conditioning the microelectrode after step (b) by heating at a temperature of between about ambient and 350.degree. C.