Patents by Inventor Petra VYCHYTILOVA

Petra VYCHYTILOVA has filed for patents to protect the following inventions. This listing includes patent applications that are pending as well as patents that have already been granted by the United States Patent and Trademark Office (USPTO).

  • Publication number: 20210130904
    Abstract: Method of diagnosing and prognosing colorectal cancer using piRNA-hsa-5937, having the sequence TCCCTGGTGGTCTAGTGGTTAGGATTCGGCA (SEQ ID NO. 1), as a biomarker, in combination with at least one miRNA selected from: (SEQ?ID?NO.?3) miR-23a-3p,?having?the?sequence AUCACAUUGCCAGGGAUUUCC, (SEQ?ID?NO.?4) miR-27a-3p,?having?the?sequence UUCACAGUGGCUAAGUUCCGC, (SEQ?ID?NO.?5) miR-142-5p,?having?the?sequence CAUAAAGUAGAAAGCACUACU. The resulting method uses a body fluid as the input, is non-invasive, has a high sensitivity and specificity even in very early stages of the disease, and is cost-effective.
    Type: Application
    Filed: July 13, 2018
    Publication date: May 6, 2021
    Applicants: MASARYKOVA UNIVERZITA, MASARYKUV ONKOLOGICKY USTAV
    Inventors: Ondrej SLABY, Petra VYCHYTILOVA, Marek SVOBODA, Milana SACHLOVA