Abstract: An improved process for simultaneous preparation of sex specific and gender-neutral semisynthetic amplicons obtained by amplifying sequences of synthetic oligonucleotide primers identified as SEQ ID NOS:4 to 7 (5′GGATCCCTATlAGTG 3′; 5′GGATCCCITTTGCACTC 3′; 5CGAAATCGGTAGACGATACG3′ and 5′GGGGATAGAGGGACTTGAAC 3′) useful for sex determination, said process comprising isolating nucleic acids from any part of a papaya plant by conventional methods, amplifying the said nucleic acids in a conventional Random Amplification of polymorphic DNA Polymerase Chain Reaction (RAPD-PCR), resolving the amplified products by conventional electrophoresis method, eluting the sex specific, double stranded amplified product from the gel piece by known methods, cloning the said product in a known vector by conventional methods, sequencing the said cloned product by known methods, synthesizing the single stranded chains of synthetic oligonucleotides by known method based on the said sequence d

Abstract: The present invention features an 831-base pair DNA fragment, and a method for the preparation of semisynthetic amplicon which is useful for determining the sex of a papaya plant.