Abstract: A method of fusing a component to a sterilized storage or delivery device formed of a cyclic olefin polymer which includes forming the storage or delivery device from a cyclic olefin polymer, forming a second member or component having at least a surface layer formed of the second polymer, wherein the Hansen relative energy distance Ra/Ro of the second polymer relative to the cyclic olefin polymer is equal to or less than 0.7, applying the second member to the storage or delivery device, and heating the assembly to the sterilization temperature, thereby causing the second polymer to chemically interact with the cyclic olefin polymer, fusing the second component to the storage or delivery device. The preferred embodiment of the invention is a medical container, such as a vial, wherein the vial is formed of a cyclic olefin polymer and the cap, closure or collar is formed of a second polymer heat fused to the vial or container.

Abstract: System (100) and method for providing power supply status indications and network-originated messages on a user device interface (104) of a user device (102) coupled to an access device (110). The access device (110) receives a supply of main power from a main power supply (204), and the access device (110) is adapted to interface with a communications network (111). A backup power supply (206) is coupled to the access device (110) and is adapted to supply backup power to the access device (110) when the supply of main power (214) fails. The backup power supply (206) provides a signal indicating a power condition of the backup power supply (206) when the supply of main power (214) fails. A processor unit (208) receives the signal and generates a backup power supply status indication in response to the signal. At least one user device (102) is coupled to the access device (110) and also is adapted to receive and/or transmit information over the communications network (111) via the access unit (110).

Abstract: A board is provided that includes a pattern to facilitate attachment of the board to a frame structure. The pattern comprises a first array of marks disposed along a first imaginary line; a second array of marks disposed along a second imaginary line, said first and second imaginary lines being spaced a first predetermined distance apart; and a third array of marks disposed along a third imaginary line, said first and third imaginary lines being spaced a second predetermined distance apart. The board may be used in a variety of construction applications, where the pattern facilitates the quick attachment of the board to an underlying frame.

Abstract: A device for preparing a customizable brewed beverages comprising a housing; a fluid introduction site, located on the housing; and an ingredient extraction chamber enclosing a beverage ingredient, where the extraction chamber is contained within the confines of the housing and is connected to the fluid introduction site. The ingredient extraction chamber has a ratio of total ingredient extraction chamber volume, during extraction, to non-tamped, dry bulk ingredient volume in excess of about 1.0:1.0. The device further comprises a filter media connected to said ingredient extraction chamber, and an extraction exit site, also located on the housing. The device may optionally comprises an extraction collection chamber contained within the housing and connected to the ingredient extraction chamber. In use, the brewing device provides a brewed coffee beverage with a delta yield value in the range of about 1% to about 20%, a brew solids value in the range of about 0.2% to about 1.

Abstract: An embodiment of an object class test involves constructing objects from classes, developing a unit class test for each object, passing data into each object using the unit class test, and retrieving data from each object using the unit class test to determine if the object is functional. Accordingly, the object class test ensures that each object is functional before the objects are installed in a software development system. In addition, the object class test documents and implements source code necessary to produce standard output messages from the unit class test for each class, thus formalizing the object class test output into an easily parseable and human readable format.

Abstract: Concepts for conveniently arranging devices for the transduction of signals to and from voltage and current domains to infrared radiation domains is described. Specifically, optoelectronic components and methods of making the same are described. In one aspect, the optoelectronic component includes a base substrate having a pair of angled (or substantially perpendicular) faces with electrical traces extending therebetween. A semiconductor chip assembly is mounted on the first face of the base substrate and a photonic device is mounted on the second face. Both the semiconductor chip assembly and the photonic device are electrically connected to traces on the base substrate. The semiconductor chip assembly is generally arranged to be electrically connected to external devices. The photonic devices are generally arranged to optically communicate with one or more optical fibers. The described structure may be used with a wide variety of photonic devices.

Abstract: The present invention relates PI3K crystals, polypeptide muteins, polypeptide fragments, antibodies thereto, nucleic acids coding for these polypeptides, methods of modifying PI3K&ggr; activity, and methods of modulating PI3K&ggr; activity. These include polypeptides and methods thereof, relating to, e.g., phospholipid binding, lipid kinase activity, modulating Ras activity in activating the PI3K&ggr;, binding of PI3K&ggr; to cell membranes, and modulating protein-protein interactions with PI3K&ggr;.

Abstract: A system and method for managing multiple server computer systems on a computer network. The functions of a central management server are distributed to multiple daemons executing independently of each other on one or more computer systems. Distributing the functions of the central management server to separate multiple daemons substantially improves the reliability of a multi-server management application.

Abstract: Process for making nonwoven fibrous webs having substantial strength in the direction normal to their planes. The webs exhibit good acoustical insulation properties.

Abstract: A headset for wireless communicating with a personal electronic device, such as a wireless phone, provides audio output based on an audio signal from the personal electronic device. A secondary battery in the headset provides power for the headset and is rechargeable from a primary battery in the personal electronic device, thereby allowing the user to recharge the headset in the field. Alternatively two secondary batteries may be provided. One of the secondary batteries can be used to power the headset, while the other is connected to the personal electronic device for recharging from the primary battery. When the battery in the headset becomes depleted, the batteries are exchanged.

Abstract: A method of fusing a component to a sterilized storage or delivery device formed of a cyclic olefin polymer which includes forming the storage or delivery device from a cyclic olefin polymer, forming a second member or component having at least a surface layer formed of the second polymer, wherein the Hansen relative energy distance Ra/Ro of the second polymer relative to the cyclic olefin polymer is equal to or less than 0.7, applying the second member to the storage or delivery device, and heating the assembly to the sterilization temperature, thereby causing the second polymer to chemically interact with the cyclic olefin polymer, fusing the second component to the storage or delivery device. The preferred embodiment of the invention is a medical container, such as a vial, wherein the vial is formed of a cyclic olefin polymer and the cap, closure or collar is formed of a second polymer heat fused to the vial or container.

Abstract: A method of brewing a fluid extract using a filter pouch containing flavor extractable particles. One step is supporting a fully compliant, fluid-permeable filter pouch partially filled with flavor extractable particles such that the pouch is inclined at an angle to horizontal ranging from about 30° to about 90° so that the particles accumulate at a bottom end of the filter pouch. Another step is directing brew water to near an upper end of the filter pouch above the particles. The brew water enters the filter pouch without the need for an opening in the pouch, and drops to infiltrate the particles. The particles are partially fluidized by and suspended in the brew water and they rise with the brew water into an empty portion of the filter pouch without a need for opposing sides of the filter pouch to separate to generate internal space. A further step includes brewing a fluid extract from the particles in the filter pouch and discharging the fluid extract from the filter pouch.

Abstract: A method and apparatus for reducing track misregistration due to digital-to-analog converter quantization noise. In hard disk drive (HDD) servo control systems, quantization noises (or roundoff errors) due to the finite precision of the D/A converter (DAC) driving the VCM contribute a significant portion of the total track-misregistration (TMR). The present invention provides a quantization error feedback (QEF) technique to reduce TMR due to DAC quantization noises. The QEF technique according to the present invention offers a simple method of reshaping the spectrum of this noise to minimize its contribution to TMR. In the digital signal processor (DSP) implementation of the QEF schemes, the quantization error is monitored and accumulated in the DSP; when sufficient error has accumulated, the MSB feeding the DAC are modified such as to cancel the effect of the error.

Abstract: An apparatus for determining the position of a mechanical element wherein the mechanical element is marked in an optically readable manner, comprising reading means to provide a first output dependent on the position of the mechanical element.

Abstract: A wide pick-up of a large round baler is mounted for floating or pivoting vertically about the axis of rotation of a rotary secondary conveyor that includes a pair of centering augers at its opposite ends. Provided at each side of the pick-up is a float spring assembly including a coil tension spring and an L-shaped link. Each coil tension spring has its upper end coupled to the baler main frame by a bracket receiving a rod joined to a spring end retainer, and has its lower end defined by a hook which is received in a hole provided in an upper end of the L-shaped link. The lower end of the link is defined by a short leg which projects forwardly beneath lower rear structure of the pick-up frame and contains a kidney-shaped aperture in which a cylindrical coupler is received, the coupler being fixed to a side member of the pick-up frame.

Abstract: Tools and methods for detecting the presence of E. canis and E. chaffeensis in a sample obtained from an animal are provided. The methods employ a polymerase chain reaction and primer sets that are based on the p30 gene of E. canis and the p28 gene of E. chaffeensis. The present invention also relates to the p30 and the p28 primer sets. Each p30 primer set comprises a first primer and the second primer, both of which are from 15 to 35 nucleotides in length. The first p30 primer comprises a sequence which is complementary to a consecutive sequence, within the following sequence: CCA AGTGTCTCAC ATTTTGGTAG CTTCTCAGCT AAAGAAGAAA GCAAATCAAC TGTTGGAGTTTTTGGATTAA AACATGATTG GGATGGAAGT CCAATACTTA AGAATAAACA CGCTGACTTTACTGTTCCAA AC. SEQ ID NO.1.

Abstract: A method of operating an alternator of a motor vehicle includes the steps of monitoring an amount of stored electrical energy available to operate the vehicle, estimating a vehicle electrical load, and regulating an output of the alternator based at least in part on the amount of electrical energy available to the vehicle and the estimated vehicle electrical load.

Abstract: A set of oligonucleotide probes and method are disclosed for detecting a plurality of different target polynucleotides. The set includes a collection of different promiscuous probes each of which is capable of hybridizing to a target sequence shared between at least two of the target polynucleotides. At least one target polynucleotide comprises at least one target sequence that is shared with one or more other target polynucleotides. A predefined combination of promiscuous probes is capable of hybridizing to target sequences of said at least one target polynucleotide, wherein said predefined combination of probes provides specificity of detection of that target polynucleotide. Also disclosed are processes of identifying a set of target sequences for designing the set of oligonucleotide probes of the invention.

Abstract: An operator for opening and closing movable barriers such as garage doors comprising a pass point limit system which is a component of an operating head. The operator is responsive to remote control from a wall panel or other location remote from the operating head to enable setting and adjustment of door travel limits from a remote location, without requiring installation of limit switches separate from the operating head.

Abstract: A personal electronic device, such as a wireless phone or personal digital assistant is separable from its primary battery when it is to be used. A smaller secondary battery within the device provides power during individual uses of the device. The secondary battery is recharged by the primary battery when the device is reconnected to the primary battery. Consequently, the device is lighter and less bulky when in use due to the absence of the primary battery unit. A belt clip is disposed on the primary battery unit so as to retain the primary battery unit on the user's belt or elsewhere when the device is separated. The separable portion of the device is releasably latched to the primary battery unit so as to be secured in place when not in use.