Patents by Inventor Roger William Stich

Roger William Stich has filed for patents to protect the following inventions. This listing includes patent applications that are pending as well as patents that have already been granted by the United States Patent and Trademark Office (USPTO).

  • Methods for detecting Ehrlichia canis and Ehrlichia chaffeensis in vertebrate and invertebrate hosts
    Patent number: 6432649
    Abstract: Tools and methods for detecting the presence of E. canis and E. chaffeensis in a sample obtained from an animal are provided. The methods employ a polymerase chain reaction and primer sets that are based on the p30 gene of E. canis and the p28 gene of E. chaffeensis. The present invention also relates to the p30 and the p28 primer sets. Each p30 primer set comprises a first primer and the second primer, both of which are from 15 to 35 nucleotides in length. The first p30 primer comprises a sequence which is complementary to a consecutive sequence, within the following sequence: CCA AGTGTCTCAC ATTTTGGTAG CTTCTCAGCT AAAGAAGAAA GCAAATCAAC TGTTGGAGTTTTTGGATTAA AACATGATTG GGATGGAAGT CCAATACTTA AGAATAAACA CGCTGACTTTACTGTTCCAA AC. SEQ ID NO.1.
    Type: Grant
    Filed: August 25, 2000
    Date of Patent: August 13, 2002
    Assignee: The Ohio State University Research Foundation
    Inventors: Roger William Stich, Yasuko Rikihisa