Abstract: The present invention addresses the problem of a providing NMN having high purity and a low impurity content. The present invention is a high-purity ?-nicotinamide mononucleotide (NMN) which has a purity of 99.0 mass % or higher and in which the amounts of C11H15NO9P, C10H16N5O10P2, C9H15N3O8P, C9H15N3O7P, C9H16N4O8P, C10H15N5O7P, and C21H27N6O15P2 contained as impurities are equal to or less than a detection limit.

Abstract: The present invention relates to a calpain activation inhibitor, muscle damage inhibitor, muscle endurance improver or muscle fatigue recovery agent containing an ?-methylsulfinylalkyl isothiocyanate or physiologically acceptable salt thereof as an active ingredient, foods or beverages, pharmaceuticals or cosmetics containing the same, a pharmaceutical for the prophylaxis and/or treatment of diseases related to muscle damage or diseases related to reduced muscle mass caused by aging, and a method for the use thereof.

Abstract: The present invention relates to a calpain activation inhibitor, muscle damage inhibitor, muscle endurance improver or muscle fatigue recovery agent containing an ?-methylsulfinylalkyl isothiocyanate or physiologically acceptable salt thereof as an active ingredient, foods or beverages, pharmaceuticals or cosmetics containing the same, a pharmaceutical for the prophylaxis and/or treatment of diseases related to muscle damage or diseases related to reduced muscle mass caused by aging, and a method for the use thereof.

Abstract: A mutant AOX2 promoter wherein 1 to 3 oligonucleotide(s) GATAGGCTATTTTTGTCGCATAAAT (SEQUENCE ID NO: 2) is (are) added in the normal direction, the reverse direction or in both the normal and reverse directions at the 5' end side of a partial DNA fragment of a wild-type AOX2 promoter, a vector carrying the promoter, a transformant into which the vector has been introduced and a method for producing a heterologous protein, comprising culture of the transformant. The mutant AOX2 promoter of the present invention has a markedly enforced promoter activity as compared with wild-type AOX2 promoters. Accordingly, the promoter of the present invention is highly utilizable as a promoter to be carried by a vector capable of expressing a heterologous protein. The vector of the present invention can efficiently express and produce various useful heterologous proteins in hosts.

Abstract: A mutant AOX2 promoter obtained by mutating a sequence of natural AOX2 promoter in a manner comprising at least one of the three mutation modes of (1) a region extending upstream from nucleotide 1187 inclusive and comprising at least nucleotides 845-960 is deleted, (2) nucleotide(s) is(are) replaced in region(s) in nucleotides 1274-1314, and (3) new oligonucleotide(s) is (are) inserted in region(s) in nucleotides 1274-1314, a vector carrying said mutant AOX2 promoter, a transformant into which said vector has been introduced, and a method for producing a heterologous protein, which comprises cultivating said transformant. The promoter of the present invention has remarkably enhanced activity as compared with natural AOX2 promoter, and is highly useful as a promoter to be carried in an expression vector allowing heterologous protein expression. In addition, the vector and the transformant of the invention can efficiently express and produce various useful heterologous proteins.

Abstract: A human prourokinase mutant in which the entire or a partial epidermal growth factor domain of human prourokinase is deleted or a partial epidermal growth factor domain of human prourokinase is replaced by one or more different amino acid residues, said mutant having a longer blood half-life than naturally occurring human prourokinase while retaining prourokinase enzymatic activity. In this human prourokinase mutant the region selected from the group consisting of: (a) from asparagine (10) to cysteine (42); (b) from asparagine (10) to aspartic acid (45); and (c) from asparagine (10) to threonine (49) is missing.