Patents by Inventor Shilpi Paul

Shilpi Paul has filed for patents to protect the following inventions. This listing includes patent applications that are pending as well as patents that have already been granted by the United States Patent and Trademark Office (USPTO).

  • Primers and a screening method for identification of artemisinin producing plants
    Patent number: 7473768
    Abstract: The present invention relates to a pair of primers with forward primer of SEQ ID NO. 1 having sequence of CCAAGCTTGCTGAACGCATCGG, and reverse primer of SEQ ID No. 2 having sequence of CCAAGCTTGCCACGCAGGATTATC, and a screening method for early identification of plants Artemisia annua having high content of artemisinin and thereby helping generation of plant population with further high content of artemisinin.
    Type: Grant
    Filed: March 31, 2004
    Date of Patent: January 6, 2009
    Assignee: Council of Scientific & Industrial Research
    Inventors: Suman Preet Singh Khanuja, Shilpi Paul, Ajit Kumar Shasany, Mahendra Pandurang Darokar, Ashutosh Kumar Shukla, Madan Mohan Gupta, Anuruddha Kumar
  • High artemisinin yielding artemisia plant named ‘CIM-arogya’
    Patent number: 7375260
    Abstract: The present invention is related to the development of a novel, distinct high herb and artemisinin yielding genotype of Artemisia annua obtained through systematic marker assisted breeding followed by selection of uniform population in a methodical way wherein the genotype is distinct, uniform and stably maintainable by continuous rouging of off types in the population using DNA marker at early seedling stage from nursery itself and suitable for commercial cultivation.
    Type: Grant
    Filed: January 18, 2006
    Date of Patent: May 20, 2008
    Assignee: Council of Scientific and Industrial Research
    Inventors: Suman Preet Singh Khanuja, Shilpi Paul, Ajit Kumar Shasany, Anil Kumar Gupta, Mahendra Pandurang Darokar, Madan Mohan Gupta, Ram Kishor Verma, Govind Ram, Anuraddha Kumar, Raj Kishori Lal, Ravi Prakash Bansal, Anil Kumar Singh, Rajendra Singh Bhakuni, Sudeep Tandon
  • High Artemisinin yielding plant genotype 'CIM-Arogya'
    Publication number: 20070089211
    Abstract: The present invention is related to the development of a novel, distinct high herb and artemisinin yielding genotype of Artemisia annua obtained through systematic marker assisted breeding followed by selection of uniform population in a methodical way wherein the genotype is distinct, uniform and stably maintainable by continuous rouging of off types in the population using DNA marker at early seedling stage from nursery itself and suitable for commercial cultivation.
    Type: Application
    Filed: January 18, 2006
    Publication date: April 19, 2007
    Inventors: Suman Khanuja, Shilpi Paul, Ajit Kumar Shasany, Anil Gupta, Mahendra Darokar, Madan Gupta, Ram Verma, Govind Ram, Anuraddha Kumar, Raj Lal, Ravi Bansal, Anil Singh, Rajendra Bhakuni, Sudeep Tandon
  • High artemisinin yielding plant genotype 'CIM-Arogya'
    Publication number: 20050223447
    Abstract: The present invention is related to the development of a novel, distinct high herb and artemisinin yielding genotype of Artemisia annua obtained through systematic marker assisted breeding followed by selection of uniform population in a methodical way wherein the genotype is distinct, uniform and stably maintainable by continuous rouging of off types in the population using DNA marker at early seedling stage from nursery itself and suitable for commercial cultivation.
    Type: Application
    Filed: March 26, 2004
    Publication date: October 6, 2005
    Inventors: Suman Preet Khanuja, Shilpi Paul, Ajit Shasany, Anil Gupta, Mahendra Darokar, Madan Gupta, Ram Verma, Govind Ram, Anuraddha Kumar, Raj Lal, Ravi Bansal, Anil Singh, Rajendra Bhakuni, Sudeep Tandon
  • Primers and a screening method for identification of artemisinin producing plants
    Publication number: 20050142564
    Abstract: The present invention relates to a pair of primers with forward primer of SEQ ID NO. 1 having sequence of CCAAGCTTGCTGAACGCATCGG, and reverse primer of SEQ ID No. 2 having sequence of CCAAGCTTGCCACGCAGGATTATC, and a screening method for early identification of plants Artemisia annua having high content of artemisinin and thereby helping generation of plant population with further high content of artemisinin.
    Type: Application
    Filed: March 31, 2004
    Publication date: June 30, 2005
    Inventors: Suman Khanuja, Shilpi Paul, Ajit Shasany, Mahendra Darokar, Ashutosh Shukla, Madan Gupta, Anuruddha Kumar