Abstract: The present invention relates to combination therapies of a cytarabine conjugate and one or more anti-neoplastic agents for inhibiting cancer cell growth. In particular, the present invention relates to a conjugate of cytarabine and aspartic acid (BST-236) in combination with one or more additional anti-neoplastic agents for use in the treatment of hematological cancers.

Abstract: The present invention provides a method of treating cancer in a subject afflicted with cancer comprising administering to the subject an anti-clusterin oligonucleotide as a monotherapy to treat the cancer. The present invention also provides compositions for treating cancer in a subject afflicted with cancer, comprising an anti-clusterin oligonucleotide having the sequence CAGCAGCAGAGTCTTCATCAT (Seq. ID No.: 1). Additionally, the present invention provides pharmaceutical compositions for treating cancer in a subject afflicted with cancer, the composition comprising an anti-clusterin oligonucleotide having the sequence CAGCAGCAGAGTCTTCATCAT (Seq. ID No.: 1), wherein the anti-clusterin oligonucleotide has a phosphorothioate backbone throughout, has sugar moieties of nucleotides 1-4 and 18-21 bearing 2?-O-methoxyethyl modifications, has nucleotides 5-17 which are 2?deoxynucleotides, and has 5-methylcytosines at nucleotides 1, 4, and 19.

Abstract: The present invention provides a method of treating cancer in a subject afflicted with cancer comprising administering to the subject an anti-clusterin oligonucleotide as a monotherapy to treat the cancer. The present invention also provides compositions for treating cancer in a subject afflicted with cancer, comprising an anti-clusterin oligonucleotide having the sequence CAGCAGCAGAGTCTTCATCAT (Seq. ID No.: 1). Additionally, the present invention provides pharmaceutical compositions for treating cancer in a subject afflicted with cancer, the composition comprising an anti-clusterin oligonucleotide having the sequence CAGCAGCAGAGTCTTCATCAT (Seq. ID No.: 1), wherein the anti-clusterin oligonucleotide has a phosphorothioate backbone throughout, has sugar moieties of nucleotides 1-4 and 18-21 bearing 2?-O-methoxyethyl modifications, has nucleotides 5-17 which are 2?deoxynucleotides, and has 5-methylcytosines at nucleotides 1, 4, and 19.

Abstract: A method for treating a patient suffering from multiple sclerosis, particularly a relapsing form of multiple sclerosis, comprising periodically administering a pharmaceutical composition comprising a therapeutically effective amount of OLIGONUCLEOTIDE 1 to the patient, thereby treating the patient.

Abstract: A method for treating a patient suffering from multiple sclerosis, particularly a relapsing form of multiple sclerosis, comprising periodically administering a pharmaceutical composition comprising a therapeutically effective amount of OLIGONUCLEOTIDE 1 to the patient, thereby treating the patient.

Abstract: The present invention provides methods for treating a human patient afflicted with unresectable, advanced or metastatic non-small cell lung cancer comprising periodically administering to the human patient chemotherapy comprising an amount of docetaxel; and 640 mg of an anti-clusterin oligonucleotide having the sequence CAGCAGCAGAGTCTTCATCAT (Seq. ID No.: 1), wherein the anti-clusterin oligonucleotide has a phosphorothioate backbone throughout, has sugar moieties of nucleotides 1-4 and 18-21 bearing 2?-O-methoxyethyl modifications, has nucleotides 5-17 which are 2?deoxynucleotides, and has 5-methylcytosines at nucleotides 1, 4, and 19, thereby treating the human patient afflicted with unresectable, advanced or metastatic non-small cell lung cancer. The present invention also provides compositions and combinations, packages, and uses thereof for treating a human patient afflicted with unresectable, advanced or metastatic non-small cell lung cancer.

Abstract: A method for treating a patient suffering from multiple sclerosis, particularly a relapsing form of multiple sclerosis, comprising periodically administering a pharmaceutical composition comprising a therapeutically effective amount of OLIGONUCLEOTIDE 1 to the patient, thereby treating the patient.

Abstract: A method of treating a human patient afflicted with lung cancer comprising periodically administering to the human patient chemotherapy comprising an amount of a taxane and 640 mg of an anti-clusterin oligonucleotide having the sequence CAGCAGCAGAGTCTTCATCAT (Seq. ID No.: 1), wherein the anti-clusterin oligonucleotide has a phosphorothioate backbone throughout, has sugar moieties of nucleotides 1-4 and 18-21 bearing 2?-O-methoxyethyl modifications, has nucleotides 5-17 which are 2? deoxynucleotides, and has 5-methylcytosines at nucleotides 1, 4, and 19, thereby treating the human patient afflicted with cell lung cancer.

Abstract: A method for treating a patient suffering from multiple sclerosis, particularly a relapsing form of multiple sclerosis, comprising periodically administering a pharmaceutical composition comprising a therapeutically effective amount of OLIGONUCLEOTIDE 1 to the patient, thereby treating the patient.