Patents by Inventor Shuping Liu
Shuping Liu has filed for patents to protect the following inventions. This listing includes patent applications that are pending as well as patents that have already been granted by the United States Patent and Trademark Office (USPTO).
-
Patent number: 10726056Abstract: In one respect, there is provided a method that includes converting, into text, audio that includes a speech-based query. A first portion, a second portion, and a third portion of the text can be identified based on a semantic rule. The first portion of the text can be an operation specified by the speech-based query. The second portion of the text can be an object specified by the speech-based query. The third portion of the text can be a parameter specified by the speech-based query. A database query can be formed to include the operation being performed with respect to the object and in accordance with the parameter. Furthermore, the database query can be executed at a database. Related systems and articles of manufacture, including computer program products, are also disclosed.Type: GrantFiled: April 10, 2017Date of Patent: July 28, 2020Assignee: SAP SEInventor: Shuping Liu
-
Publication number: 20180293300Abstract: In one respect, there is provided a method that includes converting, into text, audio that includes a speech-based query. A first portion, a second portion, and a third portion of the text can be identified based on a semantic rule. The first portion of the text can be an operation specified by the speech-based query. The second portion of the text can be an object specified by the speech-based query. The third portion of the text can be a parameter specified by the speech-based query. A database query can be formed to include the operation being performed with respect to the object and in accordance with the parameter. Furthermore, the database query can be executed at a database. Related systems and articles of manufacture, including computer program products, are also disclosed.Type: ApplicationFiled: April 10, 2017Publication date: October 11, 2018Inventor: Shuping Liu
-
Patent number: 10006102Abstract: The present invention discloses a monazite and apatite paragenetic ore enrichment method. High-grade and high-recovery-rate monazite concentrate can be obtained by adopting the method through steps of ore grinding, floatation, magnetic separation and low-acid advanced leaching treatment and re-floatation. In this process, the applicable range of ore pulp temperature is wide, the process flow is short, the ore dressing conditions are mild, the energy consumption is small, the used diluted acid can be cyclically regenerated and used, the pollution is small, the environmental stress is small and the recovery rate of low-grade monazite and apatite paragenetic ores can be obviously improved.Type: GrantFiled: January 8, 2015Date of Patent: June 26, 2018Assignee: INSTITUTE OF MULTIPURPOSE UTILIZATION OF MINERAL RESOURCESInventors: Wenliang Xiong, Yaohui Yang, Shuping Liu, Chengqing Ji, Xiaobo Zeng, Jie Deng, Xiangwen Liao, Bingyan Chen, Shanzhi Deng
-
Publication number: 20160376683Abstract: The present invention discloses a monazite and apatite paragenetic ore enrichment method. High-grade and high-recovery-rate monazite concentrate can be obtained by adopting the method through steps of ore grinding, floatation, magnetic separation and low-acid advanced leaching treatment and re-floatation. In this process, the applicable range of ore pulp temperature is wide, the process flow is short, the ore dressing conditions are mild, the energy consumption is small, the used diluted acid can be cyclically regenerated and used, the pollution is small, the environmental stress is small and the recovery rate of low-grade monazite and apatite paragenetic ores can be obviously improved.Type: ApplicationFiled: January 8, 2015Publication date: December 29, 2016Inventors: WENLIANG XIONG, YAOHUI YANG, SHUPING LIU, CHENGQING JI, XIAOBO ZENG, JIE DENG, XIANGWEN LIAO, BINGYAN CHEN, SHANZHI DENG
-
Publication number: 20160369341Abstract: The present invention relates to a rs6311 test kit, which includes a probe, a primer, and a polymerase chain reaction solution, wherein said probe sequence is as follows: rs6311T-fam: CTGTGAGTGTCTGGC (SEQ. ID. NO. 1) and rs6311C-vic: CTGTGAGTGTCCGGC (SEQ. ID. NO. 2); and said primer sequence is as follows: rs6311-F: AGAGAGAACATAAATAAGGCTAGAAAACAGTA (SEQ. ID. NO. 3) and rs6311-R: CACTGTTGGCTTTGGATGGA (SEQ. ID. NO. 4). The test kit is used to determine genotype of a depression patient, in order to treat the depression patient with a combination of serotonin reuptake inhibitors (SSRI) and low dose risperidone. The actual dose of risperidone and the ratio between SSRIs and risperidone is determined by the genotype of the depression patient. The present invention determines human drug metabolism rate through a single nucleotide polymorphism and provides a platform to adjust the patient's treatment.Type: ApplicationFiled: December 16, 2015Publication date: December 22, 2016Inventors: Wen E, Qingmei Kong, Xiaojing Zhang, Hong Shao, Zhenguo Zhao, Shuping Liu, Maomao Li, Xinxia Tian
-
Patent number: 9280517Abstract: A computer-implemented artificial lift detection system, method, and software are provided for failure detection for artificial lift systems, such as sucker rod pump systems. The method includes providing artificial lift system data from an artificial lift system. Attributes are extracted from the artificial lift system data. Data mining techniques are applied to the attributes to determine whether the artificial lift system is detected to fail within a given time period. An alert is output indicative of impending artificial lift system failures.Type: GrantFiled: June 22, 2012Date of Patent: March 8, 2016Assignee: UNIVERSITY OF SOUTHERN CALIFORNIAInventors: Shuping Liu, Cauligi Srinivasa Raghavendra, Yintao Liu, Ke-Thia Yao, Oluwafemi Opeyemi Balogun, Olanrewaju Olabinjo, Dinesh Babu Chinnapparaja Gunasekaran
-
Patent number: 8988236Abstract: A computer-implemented reservoir prediction system, method, and software are provided for failure prediction for artificial lift well systems, such as sucker rod pump systems. The method includes providing well data from a production well. Attributes are extracted from the well data. Data mining is applied to the attributes to determine whether the production well is predicted to fail within a given time period. An alert is output indicative of impending production well failures.Type: GrantFiled: May 27, 2011Date of Patent: March 24, 2015Assignee: University of Southern CaliforniaInventors: Yintao Liu, Ke-Thia Yao, Shuping Liu, Cauligi Srinivasa Raghavendra, Lanre Olabinjo, Fatma Burcu Seren, Sanaz Seddighrad, Dinesh Babu Chinnapparaja Gunasekaran
-
Patent number: 8988237Abstract: A computer-implemented reservoir prediction system, method, and software are provided for failure prediction for artificial lift systems, such as sucker rod pump systems. The method includes a production well associated with an artificial lift system and data indicative of an operational status of the artificial lift system. One or more features are extracted from the artificial lift system data. Data mining is applied to the one or more features to determine whether the artificial lift system is predicted to fail within a given time period. An alert is output indicative of impending artificial lift system failures.Type: GrantFiled: December 20, 2011Date of Patent: March 24, 2015Assignee: University of Southern CaliforniaInventors: Yintao Liu, Ke-Thia Yao, Shuping Liu, Cauligi Srinivasa Raghavendra, Oluwafemi Opeyemi Balogun, Lanre Olabinjo
-
Publication number: 20140162261Abstract: The present invention relates to a rs6311 test kit, which includes a probe, a primer, and a polymerase chain reaction solution, wherein said probe sequence is as follows: rs6311T-fam: CTGTGAGTGTCTGGC (SEQ. ID. NO. 1) and rs6311C-vic: CTGTGAGTGTCCGGC (SEQ. ID. NO. 2); and said primer sequence is as follows: rs6311-F: AGAGAGAACATAAATAAGGCTAGAAAACAGTA (SEQ. ID. NO. 3) and rs6311-R: CACTGTTGGCTTTGGATGGA (SEQ. ID. NO. 4). The test kit is used to determine genotype of a depression patient, in order to treat the depression patient with a combination of serotonin reuptake inhibitors (SSRI) and low dose risperidone. The actual dose of risperidone and the ratio between SSRIs and risperidone is determined by the genotype of the depression patient. The present invention determines human drug metabolism rate through a single nucleotide polymorphism and provides a platform to adjust the patient's treatment.Type: ApplicationFiled: November 27, 2013Publication date: June 12, 2014Inventors: Wen E., Qingmei Kong, Xiaojing Zhang, Hong Shao, Zhenguo Zhao, Shuping Liu, Maomao Li, Xinxia Tian
-
Publication number: 20130080117Abstract: A computer-implemented artificial lift detection system, method, and software are provided for failure detection for artificial lift systems, such as sucker rod pump systems. The method includes providing artificial lift system data from an artificial lift system. Attributes are extracted from the artificial lift system data. Data mining techniques are applied to the attributes to determine whether the artificial lift system is detected to fail within a given time period. An alert is output indicative of impending artificial lift system failures.Type: ApplicationFiled: June 22, 2012Publication date: March 28, 2013Applicant: UNIVERSITY OF SOUTHERN CALIFORNIAInventors: Shuping LIU, Cauligi Srinivasa RAGHAVENDRA, Yintao LIU, Ke-Thia YAO, Oluwafemi Opeyemi BALOGUN, Olanrewaju OLABINJO, Dinesh Babu CHINNAPPARAJA GUNASEKARAN
-
Publication number: 20120191633Abstract: A computer-implemented reservoir prediction system, method, and software are provided for failure prediction for artificial lift systems, such as sucker rod pump systems. The method includes a production well associated with an artificial lift system and data indicative of an operational status of the artificial lift system. One or more features are extracted from the artificial lift system data. Data mining is applied to the one or more features to determine whether the artificial lift system is predicted to fail within a given time period. An alert is output indicative of impending artificial lift system failures.Type: ApplicationFiled: December 20, 2011Publication date: July 26, 2012Applicant: University of Southern CaliforniaInventors: Yintao Liu, Ke-Thia Yao, Shuping Liu, Cauligi Srinivasa Raghavendra, Oluwafemi Opeyemi Balogun, Lanre Olabinjo
-
Publication number: 20120025997Abstract: A computer-implemented reservoir prediction system, method, and software are provided for failure prediction for artificial lift well systems, such as sucker rod pump systems. The method includes providing well data from a production well. Attributes are extracted from the well data. Data mining is applied to the attributes to determine whether the production well is predicted to fail within a given time period. An alert is output indicative of impending production well failures.Type: ApplicationFiled: May 27, 2011Publication date: February 2, 2012Applicant: University of Southern CaliforniaInventors: Yintao Liu, Ke-Thia Yao, Shuping Liu, Cauligi Srinivasa Raghavendra, Lanre Olabinjo, Fatma Burcu Seren, Sanaz Seddighrad, Dinesh Babu Chinnapparaja Gunasekaran