Abstract: Disclosed is a process of having mRNA selectively adsorbed and expressed in cardiomyocytes, by coupling an aptamer which selectively targets lipid nanoparticles containing the mRNA to cardiomyocytes and does not bind to fibroblasts, to lipid nanoparticles containing the mRNA; and administering the aptamer coupled to the lipid nanoparticles containing the mRNA to a host animal under conditions suitable for expression of the mRNA in cardiomyocytes. One preferred sequence for such an aptamer is: AGCCGTTCTGGGGGGTCGACGTTGCATCGTCA (SEQ ID NO:20), and wherein the mRNA encodes Stemin and/or YAP1(5SA).

Abstract: Disclosed is a process of having mRNA selectively adsorbed and expressed in cardiomyocytes, by coupling an aptamer which selectively targets lipid nanoparticles containing the mRNA to cardiomyocytes and does not bind to fibroblasts, to lipid nanoparticles containing the mRNA; and administering the aptamer coupled to the lipid nanoparticles containing the mRNA to a host animal under conditions suitable for expression of the mRNA in cardiomyocytes. One preferred sequence for such an aptamer is: AGCCGTTCTGGGGGGTCGACGTTGCATCGTCA (SEQ ID NO:20), and wherein the mRNA encodes Stemin and/or YAP1(5SA).

Abstract: The present invention is directed to nucleic acids with biomimetic properties and methods for producing said nucleic acids. In particular, this invention relates to nucleic acids exhibiting biomimetic properties in relation to proteins such as growth factors, hormones and/or other cell signaling proteins. Biomimetic properties may generally be defined as interactive ability in the same and/or similar manner as another biological molecule. This may, for example, include interacting with a ligand-binding biomolecule, such as a cell signaling receptor, in a manner similar to a native ligand. In the case of a signaling receptor, such biomimetic nucleic acids may in general act as an agonist or an antagonist to the given receptor. They may further act in competition to a native ligand.

Abstract: A method for improving the health and viability of pancreatic islets and improving the outcome of pancreatic islet transplantations is described. The method includes incubating the islets with an IKVAV-containing laminin A chain peptide, such as PA22-2, either before or during the culturing of the islets in an RCCS bioreactor.