Patents by Inventor Steven O'Dell

Steven O'Dell has filed for patents to protect the following inventions. This listing includes patent applications that are pending as well as patents that have already been granted by the United States Patent and Trademark Office (USPTO).

  • Patent number: 12275791
    Abstract: Multi-specific binding proteins that bind to and kill human cancer cells expressing epidermal growth factor receptor 2 (HER2 or ErbB2), but does not kill non-cancerous healthy human cells expressing HER2 are described, as well as pharmaceutical compositions and therapeutic methods useful for the treatment of HER2 expressing cancer. The invention also relates to multi-specific binding proteins that trigger CD8+ T cell killing of tumor cells.
    Type: Grant
    Filed: August 7, 2019
    Date of Patent: April 15, 2025
    Assignee: Dragonfly Therapeutics, Inc.
    Inventors: Gregory P. Chang, Ann F. Cheung, Daniel Fallon, Asya Grinberg, William Haney, Steven O'Neil, Nicolai Wagtmann, Ronnie Wei, Bradley M. Lunde, Bianka Prinz
  • Patent number: 12226822
    Abstract: A method of forming electronic substrates and assemblies is provided. The method includes forming a first layer, including co-depositing a first material and a second material, where the first material and the second material are co-deposited as powders, binders, slurries, inks, or combinations thereof, and at least partially sintering or curing the first layer of co-deposited materials. Further, the method includes forming a second layer, including co-depositing the first material and the second material, and at least partially sintering or curing the second layer of co-deposited materials. Additionally, the method includes retrieving a solid electronic substrate wherein the sintered or cured first material of the first layer forms the solid electronic substrate and the sintered or cured second material of the first layer forms a feature in or on the solid electronic substrate.
    Type: Grant
    Filed: August 11, 2023
    Date of Patent: February 18, 2025
    Assignee: SCHLUMBERGER TECHNOLOGY CORPORATION
    Inventors: Steven O. Dunford, Mark Kostinovsky
  • Publication number: 20250049953
    Abstract: Treatments and methods for inhibiting late Na current use fibroblast growth factor homologous factor (FHF), an endogenous channel modulator, to inhibit late Na current with high potency. A minimal effector domain is engineered within FHF (the “FHF-inhibiting-X-region” (FixR)) as a peptide inhibitor of late Na current that may be delivered intracellularly, for example as a cell-penetrating peptide, or via viral or plasmid delivery. As a non-limiting example, human adenovirus type 5 may be genetically modified with the sequence 5?-ATGGCTGCGGCGATAGCCAGCTCCTTGATCCGGCAGAAGCGGCAGGCGAGGGAG TCCAACAGCGACCGAGTGTCGGCCTCCAAGCGCCGCTCCAGCCCCAGCAAAGAC GGGCGCTCC-3? (SEQ ID NO: 1).
    Type: Application
    Filed: August 12, 2024
    Publication date: February 13, 2025
    Inventors: Nourdine CHAKOURI, Manu BEN JOHNY, Steven O. MARX
  • Patent number: 12215157
    Abstract: Multi-specific binding proteins that bind to and kill human cancer cells expressing CD33 (Siglec-3) are described, as well as pharmaceutical compositions and therapeutic methods useful for the treatment of CD33 expressing cancer. The invention relates to multi-specific binding proteins that bind to human cancer cells expressing CD33 and exhibit high potency and maximum lysis of target cells compared to anti-CD33 monoclonal antibodies. The multi-specific binding proteins comprise a CD33-binding domain, an NKG2D-binding domain and a CD16-binding domain.
    Type: Grant
    Filed: February 20, 2019
    Date of Patent: February 4, 2025
    Assignee: Dragonfly Therapeutics, Inc.
    Inventors: Gregory P. Chang, Ann F. Cheung, Asya Grinberg, Dhruv Kam Sethi, William Haney, Bianka Prinz, Bradley M. Lunde, Ronnie Wei, Daniel Fallon, Steven O'Neil
  • Publication number: 20250032643
    Abstract: The invention relates to modified G-protein coupled receptors (GPCRs) which (i) have decreased responsiveness to an endogenous activating ligand, and (ii) may be activated by exogenous agonists, which may be relatively benign over the counter drugs such as antihistamines. The modifications comprise mutations at particular amino acid positions, relative to the unmodified GPCRs. The invention also provides methods of use comprising administration of the modified GPCRs, for example in treating a neurological circuit disorder.
    Type: Application
    Filed: May 11, 2022
    Publication date: January 30, 2025
    Inventors: Dimitri KULLMANN, Andreas LIEB, Steven O DEVENISH, Teresa KASERER
  • Patent number: 12098916
    Abstract: An exemplary inventive freeboard detection system includes a tubular watertight temperature-sensing device and a computer. The temperature-sensing device includes a printed circuit board assembly (PCBA), a potting compound, and a hollow rigid tube. Inside the tube the potting compound encapsulates the PCBA, which includes a printed circuit board (PCB) and multiple temperature sensors closely and equidistantly arrayed along the length of the tube. The temperature-sensing device is vertically secured in a partially submerged state to a vessel with the expectation that some of the vertically arrayed temperature sensors will sense air temperature and others will sense water temperature. On an ongoing basis, the computer receives signals from the temperature sensors and processes the signals to monitor freeboard values, which the computer calculates based on differences in temperature measurements corresponding to pairs of consecutive (and/or nonconsecutive) temperature sensors.
    Type: Grant
    Filed: October 17, 2021
    Date of Patent: September 24, 2024
    Assignee: The United States of America, as represented by the Secretary of the Navy
    Inventors: David A. Mellick, Steven O. Troxel
  • Publication number: 20240277161
    Abstract: A refrigerated display case chassis includes a first insulated panel and a second insulated panel. The first insulated panel has a first foam layer bounded by a first pair of thermally conductive sheets. The first insulated panel forms a first wall of the refrigerated display case chassis. The second insulated panel has a second foam layer bounded by a second pair of thermally conductive sheets. The second insulated panel forms a second wall of the refrigerated display case chassis. The second insulated panel mates with the first insulated panel to form a thermally insulated joint where, in cross-section, one sheet of the first pair of thermally conductive sheets terminates at a surface of the second foam layer. The thermally conductive sheets have a greater thermal conductivity than the first or second foam layers.
    Type: Application
    Filed: April 24, 2024
    Publication date: August 22, 2024
    Inventors: Larry William Eget, Steven O. Stubblefield, Nicholas Jeffers, Daniela Guadalupe Medina
  • Patent number: 11980300
    Abstract: A refrigerated display case chassis includes a first insulated panel and a second insulated panel. The first insulated panel has a first foam layer bounded by a first pair of thermally conductive sheets. The first insulated panel forms a first wall of the refrigerated display case chassis. The second insulated panel has a second foam layer bounded by a second pair of thermally conductive sheets. The second insulated panel forms a second wall of the refrigerated display case chassis. The second insulated panel mates with the first insulated panel to form a thermally insulated joint where, in cross-section, one sheet of the first pair of thermally conductive sheets terminates at a surface of the second foam layer. The thermally conductive sheets have a greater thermal conductivity than the first or second foam layers.
    Type: Grant
    Filed: December 6, 2021
    Date of Patent: May 14, 2024
    Assignee: Hill Phoenix, Inc.
    Inventors: Lawrence William Eget, Steven O. Stubblefield, Nicholas Jeffers, Daniela Guadalupe Medina
  • Publication number: 20240117054
    Abstract: Multi-specific binding proteins that bind NKG2D receptor, CD 16, and FLT3 are described, as well as pharmaceutical compositions and therapeutic methods useful for the treatment of autoimmune disease or cancer.
    Type: Application
    Filed: October 14, 2020
    Publication date: April 11, 2024
    Inventors: Hemanta Baruah, Gregory P. Chang, Ann F. Cheung, Asya Grinberg, Zong Sean Juo, Thomas J. McQuade, Daniel Fallon, William Haney, Steven O'Neil, Ronnie Wei
  • Patent number: 11877907
    Abstract: An orthodontic appliance is disclosed and which cooperates with both the upper and lower dental arches of a patient and which includes an archwire coupler which is attached to individual archwires that are releasably attached to individual orthodontic brackets on the anterior facing surface of a patient's teeth requiring orthodontic treatment; and a multiple section elongated telescoping assembly which is rotatably and releasably coupled to the archwires attached to the upper and lower dental arches of a patient undergoing treatment, and wherein the multiple section elongated telescoping assembly effects movement of the upper dental arch in a rearward direction, and the lower dental arch in a forward direction when the multiple section elongated telescoping assembly is in a given position along a predetermined course of travel.
    Type: Grant
    Filed: July 17, 2020
    Date of Patent: January 23, 2024
    Inventors: Terry G. Dischinger, William M. Dischinger, Steven O. Luse
  • Publication number: 20230381863
    Abstract: A method of forming electronic substrates and assemblies is provided. The method includes forming a first layer, including co-depositing a first material and a second material, where the first material and the second material are co-deposited as powders, binders, slurries, inks, or combinations thereof, and at least partially sintering or curing the first layer of co-deposited materials. Further, the method includes forming a second layer, including co-depositing the first material and the second material, and at least partially sintering or curing the second layer of co-deposited materials. Additionally, the method includes retrieving a solid electronic substrate wherein the sintered or cured first material of the first layer forms the solid electronic substrate and the sintered or cured second material of the first layer forms a feature in or on the solid electronic substrate.
    Type: Application
    Filed: August 11, 2023
    Publication date: November 30, 2023
    Inventors: Steven O. Dunford, Mark Kostinovsky
  • Patent number: 11770906
    Abstract: The disclosure provides for methods of making electrically conductive apparatus, such as circuit boards. The methods include 3D-printing a ceramic material into a ceramic substrate that includes a void. A conductive material is infused into the void. The conductive materiel forms electrically conductive connections within the apparatus. Also disclosed are apparatus formed by the methods.
    Type: Grant
    Filed: August 27, 2021
    Date of Patent: September 26, 2023
    Assignee: SCHLUMBERGER TECHNOLOGY CORPORATION
    Inventors: John Michael Beshears, Steven O. Dunford
  • Patent number: 11765839
    Abstract: A method of forming electronic substrates and assemblies is provided. The method includes depositing a material. The material is deposited as a powder or slurry. The method includes sintering the material, and retrieving an article, including a solid electronic substrate. Also provided are electronic substrates formed by additive manufacturing, and methods of deploying the same.
    Type: Grant
    Filed: October 10, 2018
    Date of Patent: September 19, 2023
    Assignee: SCHLUMBERGER TECHNOLOGY CORPORATION
    Inventors: Steven O. Dunford, Mark Kostinovsky, Lweness Mazari
  • Publication number: 20230272041
    Abstract: The present invention relates to pharmaceutical formulations for heterodimeric Fc-fused proteins which are advantageous for achieving higher titers of the proteins during production, higher stability during storage, and improved efficacy when used as a therapeutic. Also provided are dosage regimens for such heterodimeric Fc-fused proteins and pharmaceutical formulations for use in treating cancer, such as locally advanced or metastatic solid tumor.
    Type: Application
    Filed: April 22, 2021
    Publication date: August 31, 2023
    Inventors: Mitchell Bigelow, Alexandra Braun, Ann F. Cheung, Jean-Marie Cuillerot, Mark Derose, Asya Grinberg, Eva Gutierrez, Patrick Kirby, Christopher Ryan Morgan, Michael C. Naill, Steven O'Neil, Michael Shifrin, Nicolai Wagtmann
  • Patent number: 11717472
    Abstract: A skin cleansing device has a base body and a removable cleansing head. The base body houses a vacuum pump and has a mount for connecting to the removable cleansing head. The mount has an opening into the base body and a support surface. The removable cleansing head has a collection portion and a mounting portion. The collection portion defines an inlet and an internal cavity. The mounting portion has a stem defining a channel fluidly connected to the internal cavity. The cleansing head is removably connectable to the base body with the stem being configured to be received in the opening of the mount. The vacuum pump is configured to generate a fluid flow through the internal cavity and the channel into the base body such that a suction force is generated at the inlet.
    Type: Grant
    Filed: September 2, 2022
    Date of Patent: August 8, 2023
    Assignee: Rodan & Fields, LLC
    Inventors: Kathryn Pregerson Rodan, Kathy A. Fields, Steven O. Powell
  • Patent number: 11676926
    Abstract: A method for interconnecting two conductors includes creating a first nickel layer on a first conductor of an electrical component, producing a first non-gold protective layer on the first nickel layer, the first non-gold protective layer being configured to prevent the first nickel layer from oxidizing, creating a second nickel layer on a second conductor, producing a second non-gold protective layer on the second nickel layer, the second non-gold protective layer being configured to prevent the second nickel layer from oxidizing, and interconnecting the first and second nickel layers using a solder layer that interfaces with the first and second nickel layers between the first and second conductors.
    Type: Grant
    Filed: August 24, 2020
    Date of Patent: June 13, 2023
    Assignee: Schlumberger Technology Corporation
    Inventors: Mark Alex Kostinovsky, Steven O. Dunford, Lweness Mazari
  • Publication number: 20230069147
    Abstract: The disclosure provides for methods of making electrically conductive apparatus, such as circuit boards. The methods include 3D-printing a ceramic material into a ceramic substrate that includes a void. A conductive material is infused into the void. The conductive materiel forms electrically conductive connections within the apparatus. Also disclosed are apparatus formed by the methods.
    Type: Application
    Filed: August 27, 2021
    Publication date: March 2, 2023
    Inventors: John Michael Beshears, Steven O. Dunford
  • Publication number: 20230031941
    Abstract: A skin cleansing device has a base body and a removable cleansing head. The base body houses a vacuum pump and has a mount for connecting to the removable cleansing head. The mount has an opening into the base body and a support surface. The removable cleansing head has a collection portion and a mounting portion. The collection portion defines an inlet and an internal cavity. The mounting portion has a stem defining a channel fluidly connected to the internal cavity. The cleansing head is removably connectable to the base body with the stem being configured to be received in the opening of the mount. The vacuum pump is configured to generate a fluid flow through the internal cavity and the channel into the base body such that a suction force is generated at the inlet.
    Type: Application
    Filed: September 2, 2022
    Publication date: February 2, 2023
    Inventors: Kathryn Pregerson RODAN, Kathy A. FIELDS, Steven O. POWELL
  • Publication number: 20220397567
    Abstract: The method for increasing contractility in patients with systolic heart failure involves screening for candidate small molecules which block the interaction between Rad and the plasma membrane and/or block the interaction between Rad and the CaV1.2/CaV?2 complex, or between Rad and CaV?2, in order to increase cardiac contractility. A method for preventing calcium overload and arrhythmias in heart disease involves preventing the dissociation of Rad and the CaV1.2/CaV?2 complex, or between Rad and CaV?2, during beta-adrenergic system activation. Additionally, a method of screening for drugs that block interaction between an RGK GTPase protein and a ?-subunit of the calcium channel is provided. A suitable technique, such as fluorescence resonance energy transfer (FRET), may be used to assess blocking of the interaction between the RGK GTPase protein and the ?-subunit of the calcium channel for the treatment of heart disease, pain, diabetes, skeletal muscle disorders and/or central nervous system (CNS) disorders.
    Type: Application
    Filed: July 2, 2020
    Publication date: December 15, 2022
    Inventors: Steven O. MARX, Alexander KUSHNIR, Sergey ZAKHAROV, Alexander KATCHMAN, Steven P. GYGI, Marian KALOCSAY, Manu BEN-JOHNY, Henry M. COLECRAFT, Guoxia LIU
  • Patent number: D1021589
    Type: Grant
    Filed: February 25, 2022
    Date of Patent: April 9, 2024
    Assignee: SORD FISHING PRODUCTS LLC
    Inventors: Steven O Vanden Heuvel, Jeremy Nashed