Abstract: Treatments and methods for inhibiting late Na current use fibroblast growth factor homologous factor (FHF), an endogenous channel modulator, to inhibit late Na current with high potency. A minimal effector domain is engineered within FHF (the “FHF-inhibiting-X-region” (FixR)) as a peptide inhibitor of late Na current that may be delivered intracellularly, for example as a cell-penetrating peptide, or via viral or plasmid delivery. As a non-limiting example, human adenovirus type 5 may be genetically modified with the sequence 5?-ATGGCTGCGGCGATAGCCAGCTCCTTGATCCGGCAGAAGCGGCAGGCGAGGGAG TCCAACAGCGACCGAGTGTCGGCCTCCAAGCGCCGCTCCAGCCCCAGCAAAGAC GGGCGCTCC-3? (SEQ ID NO: 1).

Abstract: The method for increasing contractility in patients with systolic heart failure involves screening for candidate small molecules which block the interaction between Rad and the plasma membrane and/or block the interaction between Rad and the CaV1.2/CaV?2 complex, or between Rad and CaV?2, in order to increase cardiac contractility. A method for preventing calcium overload and arrhythmias in heart disease involves preventing the dissociation of Rad and the CaV1.2/CaV?2 complex, or between Rad and CaV?2, during beta-adrenergic system activation. Additionally, a method of screening for drugs that block interaction between an RGK GTPase protein and a ?-subunit of the calcium channel is provided. A suitable technique, such as fluorescence resonance energy transfer (FRET), may be used to assess blocking of the interaction between the RGK GTPase protein and the ?-subunit of the calcium channel for the treatment of heart disease, pain, diabetes, skeletal muscle disorders and/or central nervous system (CNS) disorders.

Abstract: The present invention provides for the incorporation of target sequences of microRNAs into the 3?UTR region of a gene of interest in nucleic acid vectors. The invention also provides for an expression system comprising such vectors, a pharmaceutical composition comprising such vectors, as well as methods of treating or preventing cardiovascular disease by using such vectors.

Abstract: The present invention provides for the incorporation of target sequences of microRNAs into the 3?UTR region of a gene of interest in nucleic acid vectors. The invention also provides for an expression system comprising such vectors, a pharmaceutical composition comprising such vectors, as well as methods of treating or preventing cardiovascular disease by using such vectors.

Abstract: The present invention provides for the incorporation of target sequences of microRNAs into the 3? UTR region of a gene of interest in nucleic acid vectors. The invention also provides for an expression system comprising such vectors, a pharmaceutical composition comprising such vectors, as well as methods of treating or preventing cardiovascular disease by using such vectors.

Abstract: This invention provides a stent for implantation in a blood vessel or other tissue, wherein the stent is coated with or contains C3 exoenzyme, a chimeric version thereof or an inhibitor of RhoA. This invention also provides a method for treating or inhibiting the onset of restenosis in a subject which comprises implanting one of the instant stents in the subject's blood vessel.

Abstract: The present invention relates to compositions containing an mTOR inhibitor, such as rapamycin or a rapamycin derivative, in combination with a PI3 kinase inhibitor and/or a leptin inhibitor, intraluminal devices configured to release such compositions, and methods for the treatment and/or prevention of intimal hyperplasia, vascular stenosis and/or restenosis comprising delivery of such compositions or intraluminal devices to subjects in need thereof. The compositions, intraluminal devices, and methods of the invention are particularly well-suited for the treatment or prevention of vascular stenosis and restenosis in obese and diabetic subjects.

Abstract: The present invention provides compositions and methods for regulating the BK channel using rottlerin and derivatives thereof. In particular, the present invention provides pharmaceutical compositions for use in treating or preventing BK channel medicated disorders including hypertension and various hyperexcitability disorders. Also provided are compositions and methods for use in post-stroke neuroprotection and in treating or preventing erectile dysfunction. The present invention further provides kits for use in treating or preventing BK channel mediated disorders, comprising the compositions of the present invention.

Abstract: This invention provides a stent for implantation in a blood vessel or other tissue, wherein the stent is coated with or contains C3 exoenzyme, a chimeric version thereof or an inhibitor of RhoA. This invention also provides a method for treating or inhibiting the onset of restenosis in a subject which comprises implanting one of the instant stents in the subject's blood vessel.

Abstract: This invention provides a stent for implantation in a blood vessel or other tissue, wherein the stent is coated with or contains C3 exoenzyme, a chimeric version thereof or an inhibitor of RhoA. This invention also provides a method for treating or inhibiting the onset of restenosis in a subject which comprises implanting one of the instant stents in the subject's blood vessel.

Abstract: The present invention provides HDAC inhibitors for use in inhibiting proliferation and/or migration of smooth muscle cells. The present invention further provides medical devices coated with the HDAC inhibitors. The present invention also provides use of the medical devices in methods for inhibiting proliferation and/or migration of smooth muscle cells. Additionally, the present invention provides methods for inhibiting proliferation and/or migration of non-neoplastic smooth muscle cells. Finally, the present invention provides methods for preventing or treating restenosis after angioplasty or stent implantation in a subject.

Abstract: This invention is directed to a stent for implantation in a blood vessel, wherein the stent is coated with Y-27632. The invention also provides a method of treating restenosis in a subject which comprises implanting in the subject a stent coated with Y-27632.

Abstract: This invention provides methods of regulating contraction of a subject's heart and of treating heart failure and cardiac arrhythmia. This invention also provides methods of obtaining compounds that bind to, and activate or inhibit the activation of a type 2 ryanodine (RyR2) receptor, and methods for screening for compounds that alleviate heart disease.

Abstract: This invention provides a stent for implantation in a blood vessel or other tissue, wherein the stent is coated with or contains C3 exoenzyme, a chimeric version thereof or an inhibitor of RhoA. This invention also provides a method for treating or inhibiting the onset of restenosis in a subject which comprises implanting one of the instant stents in the subject's blood vessel.

Abstract: This invention provides methods of preventing cellular migration and of treating cardiovascular diseases and tumor metastasis by increasing the intracellular concentration of cyclin-dependent kinase inhibitor p27 or C3 exoenzyme or by decreasing the intracellular concentration of Rho-kinase, and methods of identifying chemical compounds for use in such treatments.

Abstract: This invention provides methods of regulating contraction of a subject's heart and of treating heart failure and cardiac arrhythmia. This invention also provides methods of obtaining compounds that bind to, and activate or inhibit the activation of a type 2 ryanodine (RyR2) receptor, and methods for screening for compounds that alleviate heart disease.

Abstract: This invention provides methods of preventing cellular migration and of treating cardiovascular diseases and tumor metastasis by increasing cyclin-dependent kinase inhibitor p27 activity, and methods of identifying chemical compounds for use in such treatments.