Abstract: The invention provides a process for purifying recombinant human serum albumin (rHSA) by heating a-culture medium containing rHSA and the rHSA-producing host cells, feeding said heated solution upwardly into a fluidized bed in which adsorbent particles are suspended to effect contacting with the adsorbent particles and then recovering the adsorbed fraction containing the rHSA, and a composition comprising rHSA which shows a A350/A280 ratio of below 0.015, when formulated into a 25% solution of said albumin.

Abstract: A method for producing a desired protein, which comprises growing, by a fed-batch culture, a host cell capable of expressing the desired protein, wherein the specific growth rate of the host cell is changed from the initial rate to a predetermined one by successively changing the rate of addition of a substrate which controls the growth of the host cell. According to the mode of change of the rate of substrate addition to the medium of the present invention, optimal patterns of specific growth rate .mu. and specific production rate .rho. can be realized to optimize the fed-batch culture system. As a consequence of the realization, it is made possible to perform a high density culture of the host cell by fed-batch culture, an the desired protein can be produced efficiently in a short time.

Abstract: Human serum albumin obtained by gene manipulation techniques can be purified by a combination of specified steps in which a culture supernatant obtained from a human serum albumin-producing host is subjected to ultrafiltration, heat treatment, acid treatment and another ultrafiltration, followed by subsequent treatments with a cation exchanger, a hydrophobic chromatography carrier and an anion exchanger, and by salting-out to thereby obtain a pure form of human serum albumin which contains substantially no proteinous and polysaccharide contaminants, which is formulated into a pharmaceutical preparation. The thus obtained human serum albumin can further be purified by treating recombinant human serum albumin with a hydrophobic chromatography carrier at pH of 2 to 5 and a salt concentration of 0.4 to 1 and exposing the carrier to a pH of 6 to 8 and a salt concentration of 0.01 to 0.

Abstract: The invention provides a process for purifying recombinant human serum albumin (rHSA) by heating a culture medium containing rHSA and the rHSA-producing host cello, feeding said heated solution upwardly into a fluidized bed in which adsorbent particles are suspended to effect contacting with the adsorbent particles and then recovering the adsorbed fraction containing the rHSA, and a composition comprising rHSA which shows a A35D/A280 ratio of below 0.015, when formulated into a 25% solution of said albumin.

Abstract: A method for decoloring a recombinant human serum albumin by treating the albumin with a reducing agent is disclosed. Also, a method for decoloring a recombinant human serum albumin by treating the albumin with a method removing free polysaccharides with a cation exchanger followed by heat treatment is disclosed. The present invention provides a recombinant human serum albumin, coloring of which is fully suppressed by preventing binding of certain coloring components, which are contained in the raw materials or contaminants secreted by a microorganism, to human serum albumin so as not to cause coloring of the human serum albumin.

Abstract: A mutant AOX2 promoter wherein 1 to 3 oligonucleotide(s) GATAGGCTATTTTTGTCGCATAAAT (SEQUENCE ID NO: 2) is (are) added in the normal direction, the reverse direction or in both the normal and reverse directions at the 5' end side of a partial DNA fragment of a wild-type AOX2 promoter, a vector carrying the promoter, a transformant into which the vector has been introduced and a method for producing a heterologous protein, comprising culture of the transformant. The mutant AOX2 promoter of the present invention has a markedly enforced promoter activity as compared with wild-type AOX2 promoters. Accordingly, the promoter of the present invention is highly utilizable as a promoter to be carried by a vector capable of expressing a heterologous protein. The vector of the present invention can efficiently express and produce various useful heterologous proteins in hosts.

Abstract: A recombinant human serum albumin (rHSA) pharmaceutical preparation is sterilized by subjecting a pharmaceutical preparation of rHSA obtained by gene manipulation techniques packed in a container in an administration unit to heat treatment at 50.degree. to 80.degree. C. for 30 minutes or more. By the disclosed method, rHSA having high safety can be provided since microorganisms contaminated in rHSA pharmaceutical preparations die as a result of the sterilization method of the present invention.

Abstract: A mutant AOX2 promoter obtained by mutating a sequence of natural AOX2 promoter in a manner comprising at least one of the three mutation modes of (1) a region extending upstream from nucleotide 1187 inclusive and comprising at least nucleotides 845-960 is deleted, (2) nucleotide(s) is(are) replaced in region(s) in nucleotides 1274-1314, and (3) new oligonucleotide(s) is (are) inserted in region(s) in nucleotides 1274-1314, a vector carrying said mutant AOX2 promoter, a transformant into which said vector has been introduced, and a method for producing a heterologous protein, which comprises cultivating said transformant. The promoter of the present invention has remarkably enhanced activity as compared with natural AOX2 promoter, and is highly useful as a promoter to be carried in an expression vector allowing heterologous protein expression. In addition, the vector and the transformant of the invention can efficiently express and produce various useful heterologous proteins.

Abstract: A method for highly purifying human serum albumin (HSA), which comprises bringing a fraction containing HSA produced by genetic engineering into contact with a chelating chromatography carrier bound with copper ions, and eluting the HSA adsorbed by the carrier with a buffer containing ammonium chloride as an atagonist and having a pH of about 5-7.According to the method of the present invention, a component derived from yeast, which cannot be sufficiently removed by conventional purification methods for HSA produced by genetic engineering, can be removed from HSA produced by genetic engineering, and a highly purified HSA can be provided.

Abstract: A methylotrophic and glucotrophic mutant strain capable of producing a heterologous protein and a method for producing a heterologous protein, comprising culture of the mutant strain. The mutant strain of the present invention can be grown in a medium containing both methanol and glucose, with the effect that the growth of the strain and production of a heterologous protein proceed at the same time. Accordingly, a heterologous protein can be produced in a large amount in a short time.

Abstract: A process for producing recombinant human serum albumin is disclosed, which comprises culturing a human serum albumin-producing host, prepared by gene manipulation techniques in a medium that contains an amino acid, preferably at least one amino acid selected from the group consisting of alanine, aspartic acid, glutamic acid, histidine, serine, tryptophan, valine, isoleucine, phenylalanine, cysteine and arginine, more preferably histidine. The process can significantly increase the yield of human serum albumin over that produced by known processes.

Abstract: Human serum albumin obtained by gene manipulation techniques can be purified by a combination of specified steps in which a culture supernatant obtained from a human serum albumin-producing host is subjected to ultrafiltration, heat treatment, acid treatment and another ultrafiltration, followed by subsequent treatments with a cation exchanger, a hydrophobic chromatography carrier and an anion exchanger, and by salting-out to thereby obtain a pure form of human serum albumin which contains substantially no proteinous and polysaccharide contaminants, which is formulated into a pharmaceutical preparation. The thus obtained human serum albumin can further be purified by treating recombinant human serum albumin with a hydrophobic chromatography carrier at pH of 2 to 5 and a salt concentration of 0.4 to 1 and exposing the carrier to a pH of 6 to 8 and a salt concentration of 0.01 to 0.

Abstract: Human serum albumin obtained by gene manipulation techniques can be purified by a combination of specified steps in which a culture supernatant obtained from a human serum albumin-producing host is subjected to ultrafiltration, heat treatment, acid treatment and another ultrafiltration, followed by subsequent treatments with a cation exchanger, a hydrophobic chromatography carrier and an anion exchanger, and by salting-out to thereby obtain a pure form of human serum albumin which contains substantially no proteinous and polysaccharide contaminants, which is formulated into a pharmaceutical preparation. This process makes it possible to effeciently purify recombinant human serum albumin and to provide substantially pure human serum albumin which does not contain producer host-related substances and other contaminants and is sufficiently free from coloration.

Abstract: A method for suppressing coloring of human serum albumin expressed by genetic engineering, which comprises culture and/or purification in the presence of an amine compound selected from the group consisting of alkylamines, diamines, guanidines, benzamidines, basic amino acids, and aminophenylacetic acids. According to the present invention, coloring of HSA expressed by genetic engineering can be suppressed to from one-half to one-tenth of that without treatment for coloring suppression. In addition, HSA can be recovered in high yields, and the treatment of the invention does not affect the inherent properties of HSA.

Abstract: A method for producing human serum albumin which comprises cultivating a human serum albumin-producing host prepared by genetic engineering, in a medium containing a fatty acid having 10 to 26 carbon atoms, or its salt, and a method for cultivating the host. HSA production can be greatly increased by the present invention.

Abstract: A method of inhibiting the coloration of human serum albumin expressed by using the gene manipulation technology which method comprises separating coloring contaminants from said human serum albumin before said coloring contaminants bind to the human serum albumin.

Abstract: A method of producing a virus-inactivated protein-containing composition from a protein-containing composition which may be contaminated with virus. The method according to the present invention permits production of pharmaceutically safer virus-inactivated protein preparations without spoiling the protein activity.

Abstract: A method of purifying human serum albumin which comprises subjecting human serum albumin-containing solution to heat treatment of about 50.degree.-70.degree. C. for 1-5 hours in the presence of acetyltryptophan and/or an organic carboxylic acid with 6-12 carbon atoms or a salt thereof.

Abstract: A fibronectin preparation in the form of an aqueous solution at least upon use is disclosed. The preparation contains at least one member selected from the group consisting of disaccharides, albumin and nonionic surface active agents as a stabilizer. The preparation has improved water-solubility when in use and high stability in an aqueous solution.

Abstract: A process for the purification of HBsAg is disclosed, which comprises adsorbing specifically on a carrier, in the presence of an inorganic salt in an amount of 5 to 25 W/V %, an HBsAg obtained by gene engineering.