Patents by Inventor Tania Fine

Tania Fine has filed for patents to protect the following inventions. This listing includes patent applications that are pending as well as patents that have already been granted by the United States Patent and Trademark Office (USPTO).

  • Patent number: 9359606
    Abstract: The present invention provides a method of treating cancer in a subject afflicted with cancer comprising administering to the subject an anti-clusterin oligonucleotide as a monotherapy to treat the cancer. The present invention also provides compositions for treating cancer in a subject afflicted with cancer, comprising an anti-clusterin oligonucleotide having the sequence CAGCAGCAGAGTCTTCATCAT (Seq. ID No.: 1). Additionally, the present invention provides pharmaceutical compositions for treating cancer in a subject afflicted with cancer, the composition comprising an anti-clusterin oligonucleotide having the sequence CAGCAGCAGAGTCTTCATCAT (Seq. ID No.: 1), wherein the anti-clusterin oligonucleotide has a phosphorothioate backbone throughout, has sugar moieties of nucleotides 1-4 and 18-21 bearing 2?-O-methoxyethyl modifications, has nucleotides 5-17 which are 2?deoxynucleotides, and has 5-methylcytosines at nucleotides 1, 4, and 19.
    Type: Grant
    Filed: March 12, 2014
    Date of Patent: June 7, 2016
    Assignee: ONCOGENEX TECHNOLOGIES INC.
    Inventors: Shoshi Tessler, Joel Kaye, Tania Fine, Rina Kashi
  • Publication number: 20140275215
    Abstract: The present invention provides a method of treating cancer in a subject afflicted with cancer comprising administering to the subject an anti-clusterin oligonucleotide as a monotherapy to treat the cancer. The present invention also provides compositions for treating cancer in a subject afflicted with cancer, comprising an anti-clusterin oligonucleotide having the sequence CAGCAGCAGAGTCTTCATCAT (Seq. ID No.: 1). Additionally, the present invention provides pharmaceutical compositions for treating cancer in a subject afflicted with cancer, the composition comprising an anti-clusterin oligonucleotide having the sequence CAGCAGCAGAGTCTTCATCAT (Seq. ID No.: 1), wherein the anti-clusterin oligonucleotide has a phosphorothioate backbone throughout, has sugar moieties of nucleotides 1-4 and 18-21 bearing 2?-O-methoxyethyl modifications, has nucleotides 5-17 which are 2?deoxynucleotides, and has 5-methylcytosines at nucleotides 1, 4, and 19.
    Type: Application
    Filed: March 12, 2014
    Publication date: September 18, 2014
    Applicant: TEVA PHARMACEUTICAL INDUSTRIES, LTD.
    Inventors: Shoshi Tessler, Joel Kaye, Tania Fine, Rina Kashi