Patents by Inventor Thomas A. Rodriguez
Thomas A. Rodriguez has filed for patents to protect the following inventions. This listing includes patent applications that are pending as well as patents that have already been granted by the United States Patent and Trademark Office (USPTO).
-
Patent number: 11993612Abstract: The present invention is directed to compounds of formula I The compounds are considered useful for the treatment of diseases associated with LRRK2 such as Parkinson's disease.Type: GrantFiled: June 8, 2023Date of Patent: May 28, 2024Assignee: H. Lundbeck A/SInventors: Thomas Jensen, Mikkel Jessing, Wanwan Yu, David Rodriguez Diaz, Jacob Nielsen, Christopher Richard Jones, Thomas Andersen, Mikkel Fog Jacobsen
-
Publication number: 20240167019Abstract: This disclosure relates generally to nucleic acid aptamers especially useful for cell transduction, as well as to containers (such as bags) having surfaces comprising one or such aptamers, and to transductions methods using such aptamers and containers. One embodiment of the disclosure provides A DNA aptamer comprising a plurality of nucleotides, the DNA aptamer having at least 80% sequence identity with the sequence of SEQ ID NO: 1 (AAACTGCAGCGATTCATTAGTACGGCCTTT).Type: ApplicationFiled: November 20, 2023Publication date: May 23, 2024Inventors: Katie Campbell, Natalie Fekete, Jonathon Wheatley, Jessica Rodriguez, Maranda Gibb, Albert M. Liao, Thomas Caltagirone
-
Patent number: 11986992Abstract: Methods for forming polyolefin films using a model including a multivariate adaptive regression splines (MARS)-derived algorithm are provided. Related computing devices are also provided.Type: GrantFiled: May 22, 2019Date of Patent: May 21, 2024Assignee: ExxonMobil Chemical Patents Inc.Inventors: George Rodriguez, Donald A. Winesett, Liezhong Gong, Thomas T. Sun
-
Publication number: 20240153626Abstract: A medical diagnostic kit are described. In one example, a medical diagnostic kit includes a container, and a plurality of medical diagnostic test kits located within the container. Each of the plurality of medical diagnostic test kits can include equipment necessary to perform a particular self-administered medical diagnostic test. The plurality of medical diagnostic test kits can include at least a first medical diagnostic kit adapted to facilitate user completion of a first medical diagnostic test and a second medical diagnostic kit adapted to facilitate user completion of a second medical diagnostic test different from the first medical diagnostic test. The container can include a machine-readable code located on an external surface of the container.Type: ApplicationFiled: October 23, 2023Publication date: May 9, 2024Inventors: Michael W. Ferro, JR., Sam Miller, Colman Thomas Bryant, Zachary Carl Nienstedt, Marco Magistri, Adam Charles Carlson, Igor Javier Rodriguez, James Thomas Heising, John Ray Permenter
-
Publication number: 20240151965Abstract: Head-mounted display systems with power saving functionality are disclosed. The systems can include a frame configured to be supported on the head of the user. The systems can also include a head-mounted display disposed on the frame, one or more sensors, and processing electronics in communication with the display and the one or more sensors. In some implementations, the processing electronics can be configured to cause the system to reduce power of one or more components in response to at least in part on a determination that the frame is in a certain position (e.g., upside-down or on top of the head of the user). In some implementations, the processing electronics can be configured to cause the system to reduce power of one or more components in response to at least in part on a determination that the frame has been stationary for at least a threshold period of time.Type: ApplicationFiled: January 16, 2024Publication date: May 9, 2024Inventors: Carlos A. Rivera Cintron, Gregory Link, Jeffrey Scott Sommers, Matthew Thomas Hull, Jose Felix Rodriguez, Ricardo Martinez Perez
-
Publication number: 20240138633Abstract: Compositions are provided for dissolvable solid unit dose formulations that can be used with a wand apparatus to clean a toilet surface. The formulations include anionic surfactant, a carbonate or bicarbonate salt, an organic acid, and virgin soap pellets wherein a ratio of the virgin soap pellets to the surfactant is from about 0.5:1 to about 2:1, preferably about 1:1 to about 1.5:1, and most preferably about 1.2:1 to 1.3:1. Compressed compositions retain sufficient hardness to facilitate cleaning a toilet surface but are still able to have a time to breakage when submerged in toilet water of less than 5 minutes to enable easy disposal by flushing with toilet water.Type: ApplicationFiled: October 28, 2022Publication date: May 2, 2024Inventors: Christopher Michael Rodriguez, Daniel Thomas Piorkowski, Juan Salas, John Daniel Konikowski
-
Publication number: 20240112060Abstract: In a general aspect, a surface code syndrome measurement is performed on a superconducting quantum processing unit. In some implementations, the superconducting quantum processing unit is caused to apply a quantum error correction code including X-type and Z-type stabilizer check patches. Each of the X-type and Z-type stabilizer check patches includes a stabilizer check qubit device and data qubit devices of the superconducting quantum processing unit. Applying the quantum error correction code includes iteratively twirling the data qubit devices in a stabilizer check patch; and evolving the stabilizer check qubit device in the stabilizer check patch and the data qubit devices in the stabilizer check patch under an interaction Hamiltonian. The interaction Hamiltonian includes a plurality of terms interactions between the stabilizer check qubit device in the stabilizer check patch and a respective one of the data qubit devices in the stabilizer check patch.Type: ApplicationFiled: September 11, 2023Publication date: April 4, 2024Applicants: Rigetti & Co, LLC, Goldman Sachs & Co. LLCInventors: Matthew J. Reagor, Thomas C. Bohdanowicz, David Rodriguez Perez, Eyob A. Sete, William J. Zeng
-
Publication number: 20240105331Abstract: A medical diagnostic kit are described. In one example, a medical diagnostic kit includes a container, and a plurality of medical diagnostic test kits located within the container. Each of the plurality of medical diagnostic test kits can include equipment necessary to perform a particular self-administered medical diagnostic test. The plurality of medical diagnostic test kits can include at least a first medical diagnostic kit adapted to facilitate user completion of a first medical diagnostic test and a second medical diagnostic kit adapted to facilitate user completion of a second medical diagnostic test different from the first medical diagnostic test. The container can include a machine-readable code located on an external surface of the container.Type: ApplicationFiled: September 18, 2023Publication date: March 28, 2024Inventors: Michael W. Ferro, Sam Miller, Colman Thomas Bryant, Zachary Carl Nienstedt, Marco Magistri, Adam Charles Carlson, Igor Javier Rodriguez, James Thomas Heising, John Ray Permenter
-
Publication number: 20240083889Abstract: This invention relates to a synthetic method for the preparation of Compound 1 and precursors thereof. Compound 1 is prepared via reaction of isoxazole 2 with phenylether (R)-3-ONa.Type: ApplicationFiled: August 24, 2023Publication date: March 14, 2024Inventors: Katrin BAER, Gisela BODENBACH, Jack Delbert BROWN, Rosemarie Karoline COLLET, Daniel HERKOMMER, Rogelio P. FRUTOS, Joe Ju GAO, Julia Regina GRIMM, Sandra KOCH, Sonia RODRIGUEZ, Svetlana SEHL-OLLENBERGER, Joshua Daniel SIEBER, Thomas G. TAMPONE, Ulrich THEIS, Dirk WEBER, Erik WEIS, Anke WILD
-
Publication number: 20240067897Abstract: A compressed unit dose toilet cleaning tablet for use with a wand. The composition contains an anionic surfactant, a carbonate or bicarbonate salt, an organic acid, and about 10% to about 40% by weight polyethylene glycol having molecular weight greater than 3,350. A unit dose of the composition is compressed into a tablet or puck that dissolves in toilet water after cleaning.Type: ApplicationFiled: August 26, 2022Publication date: February 29, 2024Applicant: Henkel AG & Co. KGaAInventors: Daniel Thomas Piorkowski, Christopher Michael Rodriguez, Janet Coope-Epstein, Sabine Schuemann, Peter Schmiedel
-
Publication number: 20220051509Abstract: A wireless network, mobile systems and methods for controlling access to lockers, strollers, wheel chairs and electronic convenience vehicles and other networked devices provided with machine-readable codes that are scanned by mobile phones and computing devices.Type: ApplicationFiled: August 11, 2020Publication date: February 17, 2022Applicant: Safemark Systems, L.P.Inventors: Mark Christopher Schmidt, Wesley Edward Swogger, Edward Joel Rodriguez, Thomas Dwayne Taylor, Michael Buchoff Buchoff, Sowmya Balda, Kyle Clarennce West, Stephanie Cornelia Lutz, Marc Maxwell Barber, Kevin George Miranda, Brian William Rood, Thomas Rodriguez
-
Publication number: 20070153952Abstract: A frequency modulated output of a digital locked loop (DLL) is implemented with a Johnson Counter outputting a sample clock and a synchronized digital code at a multiple of the sample clock. The digital code drives a digital-to-analog converter to generate a frequency modulated control signal. The control signal is summed with the center frequency control from the digital locked loop digital filter to provide a frequency modulated center frequency control signal to the DLL oscillator.Type: ApplicationFiled: December 30, 2005Publication date: July 5, 2007Inventors: Scott Herrin, Chris Dao, Patrick Falvey, Thomas Rodriguez, Jules Campbell
-
Patent number: 6377604Abstract: A current-conducting arm for conducting a current from at least one cable supports to an electrode in an electric arc furnace comprising an arm housing having a U-shaped base channel member and a U-shaped top channel member. Both channel members have a first and second wall, with the top channel member being inverted such that the first wall of the top channel member can be joined with the first wall of the base channel member, and the second wall of the top channel member can be joined with the second wall of the base channel member. The arm housing therefore has four annular corners to improve the conduction of current through the arm housing to the electrode. The invention further includes a spring assembly used to provide to aid an electrode holder in clamping the electrode. Moreover, a laser pointer is included for guiding the positioning of the arm housing in the electric arc furnace.Type: GrantFiled: November 9, 2000Date of Patent: April 23, 2002Assignee: Dixie Arc, Inc.Inventor: Gregory Thomas Rodriguez
-
Patent number: 6349327Abstract: A computer system and method provide networked computer users with information about which other users are task proximate to the user, thereby facilitating spontaneous communications regarding task-related, or other, issues. The information about other users is displayed in a user interface window on each computer that presents a visual representation of each user who is task proximate to the user operating the computer. Task proximity to other users may change as the user context switches between applications, and the user interface window is updated accordingly. Task proximity is determined individually by different applications. One exemplary system architecture for providing the information includes a person object representing each user, and storing the visual representation of the user. An encounter window on each computer displays the visual representations. A number of encounter-aware applications may execute on each computer.Type: GrantFiled: December 1, 1998Date of Patent: February 19, 2002Assignee: Sun Microsystems, Inc.Inventors: John Tang, Ellen Isaacs, Trevor Morris, Thomas Rodriguez, Alan Ruberg, Rick Levenson
-
Patent number: 5960173Abstract: A computer system and method provide networked computer users with information about which other users are task proximate to the user, thereby facilitating spontaneous communications regarding task-related, or other, issues. The information about other users is displayed in a user interface window on each computer that presents a visual representation of each user who is task proximate to the user operating the computer. Task proximity to other users may change as the user context switches between applications, and the user interface window is updated accordingly. Task proximity is determined individually by different applications. One exemplary system architecture for providing the information includes a person object representing each user, and storing the visual representation of the user. An encounter window on each computer displays the visual representations. A number of encounter-aware applications may execute on each computer.Type: GrantFiled: December 22, 1995Date of Patent: September 28, 1999Assignee: Sun Microsystems, Inc.Inventors: John Tang, Ellen Isaacs, Trevor Morris, Thomas Rodriguez, Alan Ruberg, Rick Levenson
-
Patent number: 5793365Abstract: A system and method provides each networked computer user with a user interface displaying visual representations of selected other computer users, generally of those workers in the user's workgroup, and further provides communication mechanisms for efficiently and easily contacting any of the displayed workers. The visual representations of the other users are frequently updated to indicate the activity level of these users. These activity level cues help users predict if the other users are likely to be available for an interaction. The user interface also includes a display portion and mechanism for storing data files and the like so that all workgroup members may accumulate a set data files commonly used by the workgroup, and may transfer files in this manner to other workgroup members. The data files may be stored in association with specific interactive discussion windows, known as chat rooms, or directly in the user interface.Type: GrantFiled: January 2, 1996Date of Patent: August 11, 1998Assignee: Sun Microsystems, Inc.Inventors: John Tang, Ellen Isaacs, Trevor Morris, Thomas Rodriguez, Alan Ruberg, Rick Levenson
-
Patent number: 4439085Abstract: A handcart for banquet tables and the like. The handcart has a main support shaft supported on wheels with a handle portion at one end and a transverse cradle like member at the opposite end engageable with a cross leg brace of the table. The handcart may be operated to lift one end of the table with the handcart cradle and then support the table by a collapsible rigid table brace supported by the shaft between the handle portion and the handcart wheels. The table completely supported and balanced upon the handcart may then be moved with all legs off the ground by grasping the end of the table near the handle portion and moving it like a wheelbarrow.Type: GrantFiled: October 26, 1981Date of Patent: March 27, 1984Inventors: Thomas A. Rodriguez, Angelo J. Zavaglia