Abstract: The present invention relates generally to immunostimulatory nucleic acids, compositions thereof and methods of using the immunostimulatory nucleic acids. In particular the invention relates to palindrome-containing immunostimulatory nucleic acids and the use of these nucleic acids in treating disease.

Abstract: The invention relates to a class of soft or semi-soft CpG immunostimulatory oligonucleotides that are useful for stimulating an immune response.

Abstract: The invention relates to a class of soft or semi-soft CpG immunostimulatory oligonucleotides that are useful for stimulating an immune response.

Abstract: Immunostimulatory oligonucleotides, which contain a CpG immunostimulatory motif and a second motif that is capable of forming secondary structure, including duplex and higher order structures in vitro and in vivo, are disclosed. They include nucleic acids, or pharmaceutically acceptable salts thereof, having base sequences that include 5? TCGTCGTTTTCGGCGCGCGCCGT 3? (SEQ ID NO: 1), in which each C is unmethylated and 3? refers to the 3? end of the nucleic acid. The oligonucleotides activate B cells and NK cells and induce expression of type I interferon and interferon-?. The oligonucleotides are useful for treating a variety of disorders and conditions, including allergy, asthma, infection, and cancer. In addition to their use as single agents and as combination therapies, the disclosed oligonucleotides are useful as adjuvants in vaccines.

Abstract: Immunostimulatory oligonucleotides, which contain a CpG immunostimulatory motif and a second motif that is capable of forming secondary structure, including duplex and higher order structures in vitro and in vivo, are disclosed. They include nucleic acids, or pharmaceutically acceptable salts thereof, having base sequences that include 5? TCGTCGTTTTCGGCGCGCGCCGT 3? (SEQ ID NO: 1), in which each C is unmethylated and 3? refers to the 3? end of the nucleic acid. The oligonucleotides activate B cells and NK cells and induce expression of type I interferon and interferon-?. The oligonucleotides are useful for treating a variety of disorders and conditions, including allergy, asthma, infection, and cancer. In addition to their use as single agents and as combination therapies, the disclosed oligonucleotides are useful as adjuvants in vaccines.

Abstract: The invention relates to specific C-Class semi-soft CpG immunostimulatory oligonucleotides that are useful for stimulating an immune response. In particular the oligonucleotides are useful for treating allergy, such as allergic rhinitis and asthma, cancer and infectious disease, such as hepatitis B and hepatitis C.

Abstract: The invention relates to specific C-Class semi-soft CpG immunostimulatory oligonucleotides that are useful for stimulating an immune response. In particular the oligonucleotides are useful for treating allergy, such as allergic rhinitis and asthma, cancer and infectious disease, such as hepatitis B and hepatitis C.

Abstract: The invention relates to specific C-Class semi-soft CpG immunostimulatory oligonucleotides that are useful for stimulating an immune response. In particular the oligonucleotides are useful for treating allergy, such as allergic rhinitis and asthma, cancer and infectious disease, such as hepatitis B and hepatitis C.

Abstract: The invention relates to specific C-Class semi-soft CpG immunostimulatory oligonucleotides that are useful for stimulating an immune response. In particular the oligonucleotides are useful for treating allergy, such as allergic rhinitis and asthma, cancer and infectious disease, such as hepatitis B and hepatitis C.

Abstract: Immunostimulatory oligonucleotides, which contain a CpG immunostimulatory motif and a second motif that is capable of forming secondary structure, including duplex and higher order structures in vitro and in vivo, are disclosed. They include nucleic acids, or pharmaceutically acceptable salts thereof, having base sequences that include 5? TCGTCGTTTTCGGCGCGCGCCGT 3? (SEQ ID NO: 1), in which each C is unmethylated and 3? refers to the 3? end of the nucleic acid. The oligonucleotides activate B cells and NK cells and induce expression of type I interferon and interferon-?. The oligonucleotides are useful for treating a variety of disorders and conditions, including allergy, asthma, infection, and cancer. In addition to their use as single agents and as combination therapies, the disclosed oligonucleotides are useful as adjuvants in vaccines.

Abstract: The present invention relates generally to immunostimulatory nucleic acids, compositions thereof and methods of using the immunostimulatory nucleic acids. In particular the invention relates to palindrome-containing immunostimulatory nucleic acids and the use of these nucleic acids in treating disease.

Abstract: The invention relates to a class of short CpG immunostimulatory oligonucleotides that are useful for stimulating an immune response. Preferably the short oligonucleotides are soft or semi-soft oligonucleotides.

Abstract: The invention relates to a class of soft or semi-soft CpG immunostimulatory oligonucleotides that are useful for stimulating an immune response.

Abstract: The invention relates to a class of short CpG immunostimulatory oligonucleotides that are useful for stimulating an immune response. Preferably the short oligonucleotides are soft or semi-soft oligonucleotides.

Abstract: The invention relates to specific C-Class semi-soft CpG immunostimulatory oligonucleotides that are useful for stimulating an immune response. In particular the oligonucleotides are useful for treating allergy, such as allergic rhinitis and asthma, cancer and infectious disease, such as hepatitis B and hepatitis C.

Abstract: The invention relates to a class of soft or semi-soft CpG immunostimulatory oligonucleotides that are useful for stimulating an immune response.