Patents by Inventor Vigneswary Mala Ratnamohan

Vigneswary Mala Ratnamohan has filed for patents to protect the following inventions. This listing includes patent applications that are pending as well as patents that have already been granted by the United States Patent and Trademark Office (USPTO).

  • Detection of human herpes virus 6 (HHV6)
    Publication number: 20040018488
    Abstract: The present invention relates to methods for detecting viral pathogens, particularly human herpes virus 6 (HHV6), preferable using polymerase chain reaction (PCR) techniques. The present invention also relates to primer sequences useful in these methods. In a first aspect, the present invention consists in an isolated nucleic acid molecule complementary to and specific for human herpes virus 6 (HHV6) DNA including a sequence selected from the group consisting of 5′ CTTCTGTTTTACAGGAGT (SEQ ID NO:1). 5′ACAATTGCCATTTCGGGGAAGTAC (SEQ ID N0:2), and functionally equivalent sequences.
    Type: Application
    Filed: July 31, 2003
    Publication date: January 29, 2004
    Applicant: Westmead Institute of Health Research
    Inventors: Vigneswary Mala Ratnamohan, Anthony Lawrence Cunningham
  • Detection of human herpes virus 6 (HHV6)
    Patent number: 6627418
    Abstract: The present invention relates to methods for detecting viral pathogens, particularly human herpes virus S (HHV6), preferably using polymerase chain reaction (PCR) techniques. Primer sequences useful in these methods are also described. In a first aspect, the invention provides an isolated nucleic add molecule complementary to and specific for human herpes virus 6 (HHV6) DNA including a sequence selected from 5′CTTCTGTTTTAAGTCGTACAGGAGT (SEQ ID NO: 1), 5′ACAATTGCCATTTCGGGGAAGTAC (SEQ ID NO: 2), and functionally equivalent sequences. A method for detecting HHV6 in a sample suspected of containing HHV6 is also provided.
    Type: Grant
    Filed: May 15, 2001
    Date of Patent: September 30, 2003
    Assignee: Westmead Institute of Health Research
    Inventors: Vigneswary Mala Ratnamohan, Anthony Lawrence Cunningham